Incidental Mutation 'R1452:Robo2'
ID161101
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 039507-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R1452 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73961910 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 662 (V662L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect probably damaging
Transcript: ENSMUST00000116586
AA Change: V662L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: V662L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117200
AA Change: V658L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: V658L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117785
AA Change: V658L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: V658L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226478
AA Change: V662L

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000227347
AA Change: V662L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000231889
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense not run
R7092:Robo2 UTSW 16 73956643 missense not run
R7136:Robo2 UTSW 16 73956550 missense not run
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGACTGTTTTCGATTCACTGTCCA -3'
(R):5'- GGACGACTAAGGAACCTTCCTCCA -3'

Sequencing Primer
(F):5'- CCTTGGAACTCGTTAAAATACGGC -3'
(R):5'- AAGTCAGTAAGGTTCTTGGCACC -3'
Posted On2014-03-14