Incidental Mutation 'R1422:4931408C20Rik'
List |< first << previous [record 21 of 1871] next >> last >|
ID161107
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 26682466 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1211 (S1211T)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097801
AA Change: S1211T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: S1211T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGTCACAGGCTCTAAGGACAATGC -3'
(R):5'- TCACAGCCCAATGTTAATGCCCAG -3'

Sequencing Primer
(F):5'- CTAAGGACAATGCCTGGTTGC -3'
(R):5'- TTAATGCCCAGAGAGCCTGTG -3'
Posted On2014-03-14