Incidental Mutation 'R1423:Tpst2'
ID161166
Institutional Source Beutler Lab
Gene Symbol Tpst2
Ensembl Gene ENSMUSG00000029344
Gene Nameprotein-tyrosine sulfotransferase 2
SynonymsD5Ucla3, grm, Tango13b, grt
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R1423 (G1)
Quality Score100
Status Validated
Chromosome5
Chromosomal Location112276691-112315361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112307622 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 9 (L9Q)
Ref Sequence ENSEMBL: ENSMUSP00000114592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031287] [ENSMUST00000071455] [ENSMUST00000151947]
Predicted Effect probably benign
Transcript: ENSMUST00000031287
AA Change: L9Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031287
Gene: ENSMUSG00000029344
AA Change: L9Q

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 272 8.8e-19 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071455
AA Change: L9Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071399
Gene: ENSMUSG00000029344
AA Change: L9Q

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 276 8.4e-16 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134071
Predicted Effect probably benign
Transcript: ENSMUST00000140262
SMART Domains Protein: ENSMUSP00000116816
Gene: ENSMUSG00000029344

DomainStartEndE-ValueType
PDB:3AP2|B 2 63 4e-36 PDB
SCOP:d1fmja_ 3 55 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151947
AA Change: L9Q

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000198502
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show a delayed rise and a prolonged deficit of pituitary growth hormone resulting in delayed pubertal growth, hypothyroidism, and an enlarged adenohypophysis with aberrant chromophobic cells. Homozygous null mice show a modest but transient pubertal growth lag and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Tpst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Tpst2 APN 5 112309858 missense probably damaging 1.00
IGL03268:Tpst2 APN 5 112308225 missense probably damaging 1.00
blooming UTSW 5 112307757 missense probably benign
R1175:Tpst2 UTSW 5 112308045 missense probably damaging 1.00
R1537:Tpst2 UTSW 5 112308420 missense possibly damaging 0.48
R2013:Tpst2 UTSW 5 112308014 missense probably damaging 1.00
R4624:Tpst2 UTSW 5 112308296 missense probably damaging 1.00
R4873:Tpst2 UTSW 5 112309821 nonsense probably null
R4875:Tpst2 UTSW 5 112309821 nonsense probably null
R5272:Tpst2 UTSW 5 112307952 missense probably damaging 1.00
R6123:Tpst2 UTSW 5 112308218 missense probably damaging 1.00
R6487:Tpst2 UTSW 5 112308123 missense probably damaging 1.00
R6605:Tpst2 UTSW 5 112276734 start gained probably benign
R6688:Tpst2 UTSW 5 112307757 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTTGAATCTTGCTGTCCACCTG -3'
(R):5'- ACAAAGATGAGTGGCATGGCCTTG -3'

Sequencing Primer
(F):5'- TGTCCACCTGAGGCTCTGAG -3'
(R):5'- TGCCATAGCGGTACTCCAC -3'
Posted On2014-03-14