Incidental Mutation 'R1423:Helb'
ID161174
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Namehelicase (DNA) B
SynonymsD10Ertd664e
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120083608-120112987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120108966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 222 (I222F)
Ref Sequence ENSEMBL: ENSMUSP00000116954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000154501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020449
AA Change: I222F

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228
AA Change: I222F

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154501
AA Change: I222F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228
AA Change: I222F

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Meta Mutation Damage Score 0.0428 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 120098245 missense possibly damaging 0.88
IGL00516:Helb APN 10 120105424 missense probably damaging 1.00
IGL00924:Helb APN 10 120110984 missense probably benign 0.01
IGL00971:Helb APN 10 120094263 missense possibly damaging 0.50
IGL01142:Helb APN 10 120111144 missense probably damaging 1.00
IGL01483:Helb APN 10 120111138 missense probably damaging 1.00
IGL01688:Helb APN 10 120108980 missense probably damaging 0.99
IGL01860:Helb APN 10 120102833 missense probably damaging 0.97
IGL02298:Helb APN 10 120101526 missense probably damaging 1.00
IGL02501:Helb APN 10 120102788 missense possibly damaging 0.96
IGL02554:Helb APN 10 120089712 missense probably damaging 1.00
IGL02810:Helb APN 10 120091703 missense possibly damaging 0.48
IGL02902:Helb APN 10 120089485 missense probably benign 0.00
IGL03405:Helb APN 10 120089796 missense probably damaging 1.00
R0004:Helb UTSW 10 120108981 missense probably damaging 1.00
R0092:Helb UTSW 10 120089808 missense probably damaging 1.00
R0436:Helb UTSW 10 120094212 splice site probably benign
R0850:Helb UTSW 10 120105367 missense probably damaging 1.00
R1663:Helb UTSW 10 120105433 missense probably damaging 1.00
R1756:Helb UTSW 10 120094242 missense probably damaging 0.96
R1812:Helb UTSW 10 120089566 nonsense probably null
R1976:Helb UTSW 10 120094263 missense possibly damaging 0.50
R2049:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2063:Helb UTSW 10 120105766 missense probably benign
R2141:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2180:Helb UTSW 10 120105448 missense probably benign 0.02
R2432:Helb UTSW 10 120105537 missense probably benign 0.01
R3030:Helb UTSW 10 120089582 nonsense probably null
R3874:Helb UTSW 10 120106037 missense probably benign 0.31
R3978:Helb UTSW 10 120089625 missense probably benign
R4731:Helb UTSW 10 120094288 critical splice acceptor site probably null
R4734:Helb UTSW 10 120084849 missense probably benign
R4748:Helb UTSW 10 120084849 missense probably benign
R4749:Helb UTSW 10 120084849 missense probably benign
R4840:Helb UTSW 10 120084858 missense probably benign 0.33
R4977:Helb UTSW 10 120110881 missense probably benign 0.01
R5149:Helb UTSW 10 120105743 missense probably benign 0.39
R5220:Helb UTSW 10 120101486 missense probably damaging 1.00
R5447:Helb UTSW 10 120102901 missense possibly damaging 0.88
R5637:Helb UTSW 10 120105448 missense probably benign 0.02
R5660:Helb UTSW 10 120111079 nonsense probably null
R5663:Helb UTSW 10 120105793 missense possibly damaging 0.61
R5806:Helb UTSW 10 120092519 missense probably damaging 1.00
R5951:Helb UTSW 10 120091748 missense possibly damaging 0.91
R6010:Helb UTSW 10 120105883 missense probably damaging 1.00
R6183:Helb UTSW 10 120112998 unclassified probably null
R6578:Helb UTSW 10 120111181 missense probably damaging 1.00
R6642:Helb UTSW 10 120084930 missense probably benign 0.17
R6666:Helb UTSW 10 120084951 missense probably damaging 0.99
R6705:Helb UTSW 10 120089811 unclassified probably null
R6746:Helb UTSW 10 120105468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCTATCTGTAACACGCAGTACATCC -3'
(R):5'- GCTGTTCATAACAAAGGAAGCAGTGACC -3'

Sequencing Primer
(F):5'- GCCAGATTTGAAGAACTCTGC -3'
(R):5'- GCAGTGACCTTGCTAGAAATTG -3'
Posted On2014-03-14