Incidental Mutation 'R1424:Fmo1'
ID161200
Institutional Source Beutler Lab
Gene Symbol Fmo1
Ensembl Gene ENSMUSG00000040181
Gene Nameflavin containing monooxygenase 1
Synonyms
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162829561-162866610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 162830066 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 502 (R502Q)
Ref Sequence ENSEMBL: ENSMUSP00000037259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046049] [ENSMUST00000134098]
Predicted Effect probably damaging
Transcript: ENSMUST00000046049
AA Change: R502Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037259
Gene: ENSMUSG00000040181
AA Change: R502Q

DomainStartEndE-ValueType
Pfam:FMO-like 2 532 1.5e-279 PFAM
Pfam:Pyr_redox_2 3 228 3.8e-13 PFAM
Pfam:NAD_binding_8 7 63 8e-7 PFAM
Pfam:K_oxygenase 73 226 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134098
SMART Domains Protein: ENSMUSP00000117398
Gene: ENSMUSG00000040181

DomainStartEndE-ValueType
Pfam:FMO-like 2 303 1.4e-168 PFAM
Pfam:Pyr_redox_2 4 280 8e-9 PFAM
Pfam:Pyr_redox_3 6 220 5.5e-16 PFAM
Pfam:NAD_binding_8 7 65 9.5e-8 PFAM
Pfam:K_oxygenase 72 224 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193766
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Fmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Fmo1 APN 1 162836246 missense probably damaging 1.00
IGL00479:Fmo1 APN 1 162830063 missense probably benign 0.00
IGL01612:Fmo1 APN 1 162833599 missense probably benign 0.42
IGL01650:Fmo1 APN 1 162833584 missense probably benign 0.04
IGL02052:Fmo1 APN 1 162850060 critical splice donor site probably null
IGL02340:Fmo1 APN 1 162832990 missense probably benign 0.02
IGL03348:Fmo1 APN 1 162850151 missense possibly damaging 0.76
IGL03388:Fmo1 APN 1 162836147 missense probably benign 0.17
PIT1430001:Fmo1 UTSW 1 162830053 missense probably benign 0.00
R0279:Fmo1 UTSW 1 162830272 missense possibly damaging 0.92
R0314:Fmo1 UTSW 1 162859462 missense probably damaging 1.00
R0348:Fmo1 UTSW 1 162836135 missense probably benign 0.35
R0385:Fmo1 UTSW 1 162836204 missense possibly damaging 0.94
R0699:Fmo1 UTSW 1 162833772 missense probably benign 0.00
R1413:Fmo1 UTSW 1 162833862 missense probably damaging 0.98
R1430:Fmo1 UTSW 1 162839724 missense probably damaging 1.00
R1851:Fmo1 UTSW 1 162829985 nonsense probably null
R1929:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R1982:Fmo1 UTSW 1 162839756 missense possibly damaging 0.83
R2272:Fmo1 UTSW 1 162833855 missense probably damaging 1.00
R2568:Fmo1 UTSW 1 162836259 missense probably benign 0.00
R3787:Fmo1 UTSW 1 162830014 missense possibly damaging 0.54
R3825:Fmo1 UTSW 1 162851347 splice site probably benign
R3904:Fmo1 UTSW 1 162833768 missense possibly damaging 0.54
R4320:Fmo1 UTSW 1 162833631 missense probably damaging 1.00
R4367:Fmo1 UTSW 1 162833648 nonsense probably null
R4431:Fmo1 UTSW 1 162833712 missense possibly damaging 0.76
R4473:Fmo1 UTSW 1 162850163 missense possibly damaging 0.90
R5340:Fmo1 UTSW 1 162829982 missense probably benign 0.39
R5354:Fmo1 UTSW 1 162830145 missense probably benign 0.01
R5479:Fmo1 UTSW 1 162850224 missense probably damaging 0.99
R5930:Fmo1 UTSW 1 162839616 critical splice donor site probably null
R6148:Fmo1 UTSW 1 162851519 missense probably damaging 0.99
R6160:Fmo1 UTSW 1 162836298 missense probably benign 0.00
R6164:Fmo1 UTSW 1 162851410 missense probably benign 0.24
R6263:Fmo1 UTSW 1 162850060 critical splice donor site probably null
R7046:Fmo1 UTSW 1 162839694 missense possibly damaging 0.92
X0022:Fmo1 UTSW 1 162830000 missense possibly damaging 0.57
X0066:Fmo1 UTSW 1 162839704 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAATACCAAGCTGCCAGTGAG -3'
(R):5'- AGCATTGTAGATGCCCGTGGAC -3'

Sequencing Primer
(F):5'- GCTGCCAGTGAGGTGAAC -3'
(R):5'- CAGTAAGACATTCCCAATCTGGTG -3'
Posted On2014-03-14