Incidental Mutation 'R1424:Mmp16'
ID161210
Institutional Source Beutler Lab
Gene Symbol Mmp16
Ensembl Gene ENSMUSG00000028226
Gene Namematrix metallopeptidase 16
SynonymsMT3-MMP, Membrane type 3-MMP
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location17852893-18119145 bp(+) (GRCm38)
Type of Mutationsplice site (7 bp from exon)
DNA Base Change (assembly) A to G at 18112121 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029881] [ENSMUST00000183662]
Predicted Effect probably null
Transcript: ENSMUST00000029881
SMART Domains Protein: ENSMUSP00000029881
Gene: ENSMUSG00000028226

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 3e-11 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
HX 392 436 3.61e-12 SMART
HX 439 485 1.86e-14 SMART
HX 487 532 4.96e-10 SMART
Pfam:DUF3377 537 607 6.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183662
SMART Domains Protein: ENSMUSP00000139102
Gene: ENSMUSG00000028226

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 9.9e-12 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
Meta Mutation Damage Score 0.6424 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit retarded growth of the skeleton, especially in the cranium and long bones. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a null allele exhibit reduced skeletal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Mmp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Mmp16 APN 4 18011784 missense probably benign 0.03
IGL01074:Mmp16 APN 4 18110584 splice site probably benign
IGL01125:Mmp16 APN 4 18112066 missense possibly damaging 0.95
IGL01309:Mmp16 APN 4 18116185 missense probably damaging 0.98
IGL01543:Mmp16 APN 4 18051743 missense probably damaging 1.00
IGL02036:Mmp16 APN 4 18093371 missense probably benign 0.00
IGL02252:Mmp16 APN 4 18110523 missense probably damaging 1.00
IGL03037:Mmp16 APN 4 17996222 missense probably damaging 0.98
R0483:Mmp16 UTSW 4 18115878 splice site probably benign
R0565:Mmp16 UTSW 4 17987705 missense probably damaging 1.00
R0885:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R0966:Mmp16 UTSW 4 18115930 missense probably benign 0.31
R1158:Mmp16 UTSW 4 17987726 splice site probably null
R1290:Mmp16 UTSW 4 18051725 missense probably damaging 1.00
R1326:Mmp16 UTSW 4 18054517 missense possibly damaging 0.61
R1345:Mmp16 UTSW 4 18112021 missense probably benign 0.01
R1610:Mmp16 UTSW 4 18011582 missense probably benign 0.00
R1722:Mmp16 UTSW 4 18051767 missense probably damaging 1.00
R1867:Mmp16 UTSW 4 18116013 missense probably benign 0.00
R2354:Mmp16 UTSW 4 18112001 missense probably damaging 1.00
R2431:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R2992:Mmp16 UTSW 4 18011657 missense probably damaging 1.00
R5245:Mmp16 UTSW 4 18054596 intron probably benign
R5534:Mmp16 UTSW 4 18110452 missense probably damaging 0.99
R5941:Mmp16 UTSW 4 18054354 splice site probably benign
R5961:Mmp16 UTSW 4 17853842 missense probably benign 0.37
R6160:Mmp16 UTSW 4 18051857 missense probably damaging 1.00
R6514:Mmp16 UTSW 4 18116123 missense probably damaging 1.00
R6570:Mmp16 UTSW 4 18011501 missense possibly damaging 0.64
R6866:Mmp16 UTSW 4 17853800 missense probably benign 0.23
R7037:Mmp16 UTSW 4 18116148 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAATTGCTCCAGTAATGGCAATCAGTAATG -3'
(R):5'- TGGCTAAACTTAGGATAGTGTCTTTGGGAA -3'

Sequencing Primer
(F):5'- CACAGGAAGGAACCATCATTTAG -3'
(R):5'- GTGAGTTTATCAGGTTACTAAAAGGG -3'
Posted On2014-03-14