Incidental Mutation 'R1424:Dgka'
ID161231
Institutional Source Beutler Lab
Gene Symbol Dgka
Ensembl Gene ENSMUSG00000025357
Gene Namediacylglycerol kinase, alpha
SynonymsDagk1
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R1424 (G1)
Quality Score215
Status Validated
Chromosome10
Chromosomal Location128720134-128744855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128733333 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 177 (S177T)
Ref Sequence ENSEMBL: ENSMUSP00000152021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000219834]
Predicted Effect probably benign
Transcript: ENSMUST00000026414
AA Change: S177T

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357
AA Change: S177T

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217957
Predicted Effect possibly damaging
Transcript: ENSMUST00000219834
AA Change: S177T

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Dgka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dgka APN 10 128733086 missense probably damaging 1.00
IGL02479:Dgka APN 10 128730246 missense probably benign 0.01
IGL02727:Dgka APN 10 128722448 splice site probably benign
IGL02817:Dgka APN 10 128730228 missense probably benign
IGL02882:Dgka APN 10 128733384 missense possibly damaging 0.77
IGL03239:Dgka APN 10 128721385 splice site probably benign
R0321:Dgka UTSW 10 128721083 splice site probably benign
R0374:Dgka UTSW 10 128721083 splice site probably benign
R0482:Dgka UTSW 10 128734121 nonsense probably null
R0494:Dgka UTSW 10 128721083 splice site probably benign
R0573:Dgka UTSW 10 128737007 critical splice donor site probably null
R0594:Dgka UTSW 10 128733110 splice site probably benign
R0607:Dgka UTSW 10 128720469 unclassified probably null
R0618:Dgka UTSW 10 128721083 splice site probably benign
R0691:Dgka UTSW 10 128723260 splice site probably benign
R1378:Dgka UTSW 10 128735827 splice site probably null
R1955:Dgka UTSW 10 128730189 critical splice donor site probably null
R1972:Dgka UTSW 10 128720466 missense probably damaging 0.99
R1998:Dgka UTSW 10 128729939 missense probably benign 0.00
R2046:Dgka UTSW 10 128723535 missense probably damaging 1.00
R4206:Dgka UTSW 10 128721195 missense probably damaging 1.00
R4418:Dgka UTSW 10 128728094 missense probably damaging 1.00
R4752:Dgka UTSW 10 128736659 missense probably benign 0.03
R5092:Dgka UTSW 10 128735833 missense probably damaging 0.99
R5479:Dgka UTSW 10 128729672 critical splice acceptor site probably null
R6009:Dgka UTSW 10 128723679 missense probably damaging 1.00
R6273:Dgka UTSW 10 128723646 missense probably benign 0.03
R6852:Dgka UTSW 10 128722539 missense probably damaging 1.00
R6947:Dgka UTSW 10 128733015 missense probably damaging 1.00
R6973:Dgka UTSW 10 128729594 splice site probably null
R7024:Dgka UTSW 10 128720487 missense probably damaging 1.00
R7076:Dgka UTSW 10 128733583 missense probably damaging 0.99
R7290:Dgka UTSW 10 128733599 missense probably damaging 0.99
X0020:Dgka UTSW 10 128721317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAATCCCTGGTTCTCTGGTG -3'
(R):5'- GATGCGAGTGGCCGAATATCTAGAC -3'

Sequencing Primer
(F):5'- TATATTCCAAGACCGCACTCGC -3'
(R):5'- CCGAATATCTAGACTGGGATGTG -3'
Posted On2014-03-14