Mutagenetix > Incidental Mutation

Incidental Mutation 'R1425:Itgb2'

161260

Institutional Source

Beutler Lab

Gene Symbol

Itgb2

Ensembl Gene

ENSMUSG00000000290

Gene Name

integrin beta 2

Synonyms

Mac-1 beta, 2E6, Cd18

MMRRC Submission

039481-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.537) question?

Stock #

R1425 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

77366164-77401542 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77383130 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 167 (G167S)

Ref Sequence

ENSEMBL: ENSMUSP00000000299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000130059] [ENSMUST00000130059] [ENSMUST00000131023] [ENSMUST00000153541] [ENSMUST00000156644]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000000299
AA Change: G167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: G167S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	6.91e-7	SMART
INB	32	447	1.98e-268	SMART
VWA	126	357	1.25e-1	SMART
internal_repeat_1	459	509	7.99e-5	PROSPERO
EGF_like	535	574	6.81e1	SMART
Integrin_B_tail	622	701	5.53e-22	SMART
transmembrane domain	702	724	N/A	INTRINSIC
Integrin_b_cyt	725	770	1.58e-17	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000130059
AA Change: G89S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290
AA Change: G89S

Domain	Start	End	E-Value	Type
INB	1	130	2.21e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000130059
AA Change: G89S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290
AA Change: G89S

Domain	Start	End	E-Value	Type
INB	1	130	2.21e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131023

SMART Domains

Protein: ENSMUSP00000119657
Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
Pfam:Integrin_beta	2	54	7.1e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000153541
AA Change: G167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290
AA Change: G167S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	6.91e-7	SMART
INB	32	447	1.98e-268	SMART
VWA	126	357	1.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000156644

SMART Domains

Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PDB:2P28\|A	23	49	9e-12	PDB
Blast:PSI	24	49	2e-11	BLAST

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.4%
20x: 89.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 9 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6ap1l	T	C	13: 91,047,638 (GRCm39)	N58S	possibly damaging	Het
Gdpd4	A	T	7: 97,623,219 (GRCm39)	T277S	probably benign	Het
Kcnt2	A	G	1: 140,310,766 (GRCm39)	T191A	probably damaging	Het
Or52b1	A	T	7: 104,978,922 (GRCm39)	F159Y	probably damaging	Het
Ppm1k	C	T	6: 57,501,774 (GRCm39)	G130R	probably damaging	Het
Rfc1	A	C	5: 65,476,861 (GRCm39)	F6V	probably damaging	Het
Sec14l3	A	G	11: 4,016,487 (GRCm39)	E53G	probably damaging	Het
Tas2r115	T	G	6: 132,714,442 (GRCm39)	S170R	probably benign	Het
Zfp738	T	C	13: 67,818,894 (GRCm39)	T366A	possibly damaging	Het

Other mutations in Itgb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Itgb2	APN	10	77,393,240 (GRCm39)	missense	probably damaging	1.00
IGL00427:Itgb2	APN	10	77,393,790 (GRCm39)	missense	probably benign	0.13
IGL00500:Itgb2	APN	10	77,400,558 (GRCm39)	missense	probably damaging	1.00
IGL01019:Itgb2	APN	10	77,378,237 (GRCm39)	missense	possibly damaging	0.94
IGL01104:Itgb2	APN	10	77,383,028 (GRCm39)	splice site	probably null
IGL01111:Itgb2	APN	10	77,377,834 (GRCm39)	missense	probably damaging	0.98
IGL01574:Itgb2	APN	10	77,393,798 (GRCm39)	missense	possibly damaging	0.82
IGL02087:Itgb2	APN	10	77,395,530 (GRCm39)	missense	possibly damaging	0.94
IGL02132:Itgb2	APN	10	77,385,895 (GRCm39)	missense	probably damaging	1.00
IGL02325:Itgb2	APN	10	77,383,026 (GRCm39)	missense	probably damaging	1.00
IGL02505:Itgb2	APN	10	77,383,052 (GRCm39)	missense	probably damaging	1.00
IGL02590:Itgb2	APN	10	77,395,347 (GRCm39)	missense	probably damaging	1.00
IGL02735:Itgb2	APN	10	77,385,833 (GRCm39)	missense	possibly damaging	0.81
almondine	UTSW	10	77,384,503 (GRCm39)	missense	probably damaging	1.00
barely	UTSW	10	77,384,370 (GRCm39)	splice site	probably benign
fresh	UTSW	10	77,391,995 (GRCm39)	missense	probably damaging	0.98
joker	UTSW	10	77,549,849 (GRCm38)	intron	probably benign
newhome	UTSW	10	77,395,515 (GRCm39)	missense	probably benign	0.00
nibbler	UTSW	10	77,397,050 (GRCm39)	critical splice donor site	probably null
Only_just	UTSW	10	77,385,802 (GRCm39)	missense	possibly damaging	0.80
salmonid	UTSW	10	77,396,946 (GRCm39)	missense	probably benign
trout	UTSW	10	77,401,022 (GRCm39)	missense	probably damaging	1.00
R0217:Itgb2	UTSW	10	77,384,370 (GRCm39)	splice site	probably benign
R0394:Itgb2	UTSW	10	77,378,309 (GRCm39)	missense	probably damaging	1.00
R0396:Itgb2	UTSW	10	77,397,023 (GRCm39)	missense	probably damaging	0.97
R1499:Itgb2	UTSW	10	77,381,987 (GRCm39)	missense	possibly damaging	0.62
R1542:Itgb2	UTSW	10	77,395,320 (GRCm39)	missense	probably benign
R1803:Itgb2	UTSW	10	77,400,624 (GRCm39)	missense	probably benign	0.15
R1889:Itgb2	UTSW	10	77,384,457 (GRCm39)	missense	possibly damaging	0.74
R2035:Itgb2	UTSW	10	77,383,033 (GRCm39)	missense	probably damaging	1.00
R2156:Itgb2	UTSW	10	77,396,082 (GRCm39)	missense	probably benign	0.01
R2374:Itgb2	UTSW	10	77,395,515 (GRCm39)	missense	probably benign	0.00
R3769:Itgb2	UTSW	10	77,385,802 (GRCm39)	missense	possibly damaging	0.80
R3942:Itgb2	UTSW	10	77,393,867 (GRCm39)	missense	probably benign	0.31
R4352:Itgb2	UTSW	10	77,392,001 (GRCm39)	missense	probably benign	0.10
R4537:Itgb2	UTSW	10	77,397,050 (GRCm39)	critical splice donor site	probably null
R4600:Itgb2	UTSW	10	77,381,949 (GRCm39)	missense	probably benign
R4611:Itgb2	UTSW	10	77,385,884 (GRCm39)	missense	probably damaging	1.00
R4685:Itgb2	UTSW	10	77,385,937 (GRCm39)	critical splice donor site	probably null
R4717:Itgb2	UTSW	10	77,381,878 (GRCm39)	nonsense	probably null
R5068:Itgb2	UTSW	10	77,384,595 (GRCm39)	missense	probably damaging	1.00
R5297:Itgb2	UTSW	10	77,400,501 (GRCm39)	missense	probably damaging	1.00
R5355:Itgb2	UTSW	10	77,393,886 (GRCm39)	missense	probably benign
R5927:Itgb2	UTSW	10	77,381,868 (GRCm39)	missense	probably damaging	1.00
R6371:Itgb2	UTSW	10	77,384,431 (GRCm39)	missense	probably damaging	1.00
R6505:Itgb2	UTSW	10	77,395,507 (GRCm39)	missense	probably damaging	1.00
R7305:Itgb2	UTSW	10	77,384,398 (GRCm39)	missense	probably damaging	1.00
R7574:Itgb2	UTSW	10	77,395,992 (GRCm39)	missense	probably benign	0.18
R7606:Itgb2	UTSW	10	77,391,995 (GRCm39)	missense	probably damaging	0.98
R7772:Itgb2	UTSW	10	77,396,946 (GRCm39)	missense	probably benign
R7888:Itgb2	UTSW	10	77,400,478 (GRCm39)	missense	probably benign	0.00
R8716:Itgb2	UTSW	10	77,393,787 (GRCm39)	missense	probably damaging	0.99
R8933:Itgb2	UTSW	10	77,401,022 (GRCm39)	missense	probably damaging	1.00
R9082:Itgb2	UTSW	10	77,384,503 (GRCm39)	missense	probably damaging	1.00
R9479:Itgb2	UTSW	10	77,396,942 (GRCm39)	missense	probably benign	0.01
Z1176:Itgb2	UTSW	10	77,393,796 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACCTGGGGTGAGCCTACTTATCTG -3'
(R):5'- TCTTAGCAGCCTGTGACCAAGGAC -3'

Sequencing Primer
(F):5'- CCCTTCCAGGTCATAGGAAATGG -3'
(R):5'- CAAGGACAGCCCCTGGTAAG -3'

Posted On

2014-03-14