Incidental Mutation 'R1437:Olfr993'
ID161272
Institutional Source Beutler Lab
Gene Symbol Olfr993
Ensembl Gene ENSMUSG00000075220
Gene Nameolfactory receptor 993
SynonymsGA_x6K02T2Q125-46891524-46890580, MOR203-2
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85413933-85414877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85414874 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 2 (I2V)
Ref Sequence ENSEMBL: ENSMUSP00000097510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099926]
Predicted Effect probably benign
Transcript: ENSMUST00000099926
AA Change: I2V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097510
Gene: ENSMUSG00000075220
AA Change: I2V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1.3e-7 PFAM
Pfam:7tm_1 41 290 2.2e-21 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Olfr993
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Olfr993 APN 2 85414193 missense probably benign 0.05
IGL03209:Olfr993 APN 2 85414379 missense probably benign 0.05
R0591:Olfr993 UTSW 2 85414690 missense possibly damaging 0.95
R1836:Olfr993 UTSW 2 85414405 missense probably benign 0.36
R2084:Olfr993 UTSW 2 85414615 missense probably benign 0.01
R2902:Olfr993 UTSW 2 85414052 missense possibly damaging 0.79
R2910:Olfr993 UTSW 2 85414351 missense probably damaging 1.00
R3961:Olfr993 UTSW 2 85414872 missense possibly damaging 0.69
R4542:Olfr993 UTSW 2 85413943 missense probably benign
R4635:Olfr993 UTSW 2 85414864 missense probably damaging 1.00
R5464:Olfr993 UTSW 2 85414713 frame shift probably null
R5980:Olfr993 UTSW 2 85414165 missense probably damaging 1.00
R6139:Olfr993 UTSW 2 85414346 missense probably damaging 1.00
R6356:Olfr993 UTSW 2 85414687 missense probably damaging 1.00
R6619:Olfr993 UTSW 2 85414081 missense probably benign 0.05
R6672:Olfr993 UTSW 2 85414604 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACAGTCACAAGTAGCAAAGATTGCGT -3'
(R):5'- CTATTGGtctgtgcttctatctcctcct -3'

Sequencing Primer
(F):5'- ACAAAGGTTTGTAGCATCTTGG -3'
(R):5'- aaatgattttctggtagagtctgtg -3'
Posted On2014-03-14