Incidental Mutation 'R1437:Lcmt2'
ID161274
Institutional Source Beutler Lab
Gene Symbol Lcmt2
Ensembl Gene ENSMUSG00000074890
Gene Nameleucine carboxyl methyltransferase 2
Synonyms
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1437 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121128307-121140653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121138896 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 569 (S569P)
Ref Sequence ENSEMBL: ENSMUSP00000106302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000099486] [ENSMUST00000110662] [ENSMUST00000110665] [ENSMUST00000110674] [ENSMUST00000119031]
Predicted Effect probably benign
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099486
AA Change: S349P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097085
Gene: ENSMUSG00000074890
AA Change: S349P

DomainStartEndE-ValueType
PDB:3P71|T 4 94 6e-12 PDB
SCOP:d1k3ia3 137 401 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110662
SMART Domains Protein: ENSMUSP00000106290
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 200 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110674
AA Change: S569P

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000106302
Gene: ENSMUSG00000074890
AA Change: S569P

DomainStartEndE-ValueType
Pfam:LCM 12 207 5.4e-28 PFAM
Pfam:Kelch_3 492 542 2.2e-6 PFAM
low complexity region 544 563 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158384
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the highly variable methyltransferase superfamily. This gene is the inferred homolog of the Saccharomyces cerevisiae carboxymethyltransferase gene PPM2 that is essential for the synthesis of the hypermodified guanosine Wybutosine (yW). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Lcmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Lcmt2 APN 2 121138913 missense possibly damaging 0.94
R0352:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R0519:Lcmt2 UTSW 2 121139344 unclassified probably null
R0685:Lcmt2 UTSW 2 121139240 missense probably benign 0.14
R1500:Lcmt2 UTSW 2 121140007 missense probably benign 0.00
R1569:Lcmt2 UTSW 2 121139828 missense probably damaging 1.00
R1612:Lcmt2 UTSW 2 121139120 missense probably damaging 1.00
R1618:Lcmt2 UTSW 2 121138652 missense probably damaging 0.98
R1990:Lcmt2 UTSW 2 121140281 missense probably benign 0.07
R2091:Lcmt2 UTSW 2 121138616 missense probably damaging 1.00
R2159:Lcmt2 UTSW 2 121139285 missense probably damaging 1.00
R3812:Lcmt2 UTSW 2 121138706 missense probably benign 0.01
R4725:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4727:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4968:Lcmt2 UTSW 2 121139736 missense probably benign 0.00
R5626:Lcmt2 UTSW 2 121139462 missense probably benign
R6246:Lcmt2 UTSW 2 121140389 missense probably damaging 1.00
R6326:Lcmt2 UTSW 2 121139457 nonsense probably null
R6524:Lcmt2 UTSW 2 121138931 missense possibly damaging 0.75
R6924:Lcmt2 UTSW 2 121140003 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGCAGGAGCTGCTGCTCTTCAG -3'
(R):5'- TGGACGCCTTTATCACACCATGAC -3'

Sequencing Primer
(F):5'- GCACAGACGCTGTGTCAATC -3'
(R):5'- GCTGAACCTGTACTAAGTGACTG -3'
Posted On2014-03-14