Incidental Mutation 'R1437:Abcc8'
ID161297
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R1437 (G1)
Quality Score141
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46179813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000148198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123] [ENSMUST00000210511]
Predicted Effect probably damaging
Transcript: ENSMUST00000033123
AA Change: I46T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: I46T

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210511
AA Change: I46T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210986
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTGGCGCGAGTTCAAGGATAG -3'
(R):5'- GCTCACCCGGATCATCTTGGTTAC -3'

Sequencing Primer
(F):5'- TTCAAGGATAGGGGAGGGTG -3'
(R):5'- CATTGGGTGAGACCCCAC -3'
Posted On2014-03-14