Incidental Mutation 'R1437:Pde4a'
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R1437 (G1)
Quality Score100
Status Not validated
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 21192592 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably benign
Transcript: ENSMUST00000003395
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177

low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000039413
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177

low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115458
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177

low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140440
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcttttcctcccctggagac -3'
Posted On2014-03-14