Incidental Mutation 'R1437:Pkd1'
ID161334
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission 039492-MU
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1437 (G1)
Quality Score206
Status Not validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24595132 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 4159 (S4159T)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227058] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000227804] [ENSMUST00000228412] [ENSMUST00000228581]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: S4159T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: S4159T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097373
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116692
Predicted Effect probably benign
Transcript: ENSMUST00000226284
Predicted Effect probably benign
Transcript: ENSMUST00000226398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226691
Predicted Effect probably benign
Transcript: ENSMUST00000227058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227094
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227432
Predicted Effect probably benign
Transcript: ENSMUST00000227607
Predicted Effect probably benign
Transcript: ENSMUST00000227745
Predicted Effect probably benign
Transcript: ENSMUST00000227804
Predicted Effect probably benign
Transcript: ENSMUST00000228412
Predicted Effect probably benign
Transcript: ENSMUST00000228581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228750
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Esr1 ACGCCGCCGCCGCCGCCGCCGCCGCCGCC ACGCCGCCGCCGCCGCCGCCGCCGCC 10: 4,712,571 probably benign Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr1i3 CACTCAACACTAC CAC 1: 171,217,141 probably null Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 unclassified probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24577801 missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24574029 missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 unclassified probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24594768 missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24594112 missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24575866 missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24575051 missense probably benign 0.01
R7380:Pkd1 UTSW 17 24581642 missense probably damaging 1.00
R7407:Pkd1 UTSW 17 24594594 missense probably damaging 1.00
R7410:Pkd1 UTSW 17 24575881 missense probably damaging 1.00
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGGGAACCCCAGGACTATGAGATG -3'
(R):5'- TCGGTCAAACTGGACAAGCAGAC -3'

Sequencing Primer
(F):5'- CTGGATGGGCTTCAGCAAG -3'
(R):5'- CTTTCAAACACAGCATGGAGGC -3'
Posted On2014-03-14