Incidental Mutation 'R1427:Sec23ip'
ID161359
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene NameSec23 interacting protein
SynonymsD7Ertd373e, p125
MMRRC Submission 039483-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R1427 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128744943-128784836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128776885 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 808 (R808C)
Ref Sequence ENSEMBL: ENSMUSP00000035610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942]
Predicted Effect probably damaging
Transcript: ENSMUST00000042942
AA Change: R808C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: R808C

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104095
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,623,040 N289S probably damaging Het
Abhd12b A G 12: 70,182,419 D223G probably damaging Het
Agap3 A G 5: 24,476,693 T333A probably benign Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Clcnkb A G 4: 141,405,309 L603P probably damaging Het
Dchs1 T C 7: 105,766,191 D626G probably benign Het
Eml3 T C 19: 8,933,861 Y285H probably damaging Het
Ganab A G 19: 8,915,666 T945A probably benign Het
Iars A T 13: 49,704,269 probably null Het
Kalrn A G 16: 33,975,754 F1217S probably damaging Het
Lipf T C 19: 33,965,600 F103L probably damaging Het
Lpar2 C A 8: 69,824,050 A163E possibly damaging Het
Myh1 T C 11: 67,219,747 Y1495H probably damaging Het
Olfr487 A G 7: 108,212,094 I145T probably benign Het
Ppp3ca T A 3: 136,921,914 L413H probably damaging Het
Ptpn7 T C 1: 135,134,454 V46A possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Slc25a26 T C 6: 94,510,847 S96P probably damaging Het
Stard13 G A 5: 151,045,991 R898W probably damaging Het
Tenm4 T C 7: 96,843,048 V1063A probably benign Het
Tm6sf2 T G 8: 70,075,582 M127R probably damaging Het
Ttn A T 2: 76,753,104 W22482R probably damaging Het
Zfp384 T C 6: 125,024,884 L109P probably damaging Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128767609 missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128762405 missense probably benign 0.08
IGL01358:Sec23ip APN 7 128752797 missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128750245 missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128755311 splice site probably null
IGL02233:Sec23ip APN 7 128779179 missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128776916 missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128750305 missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128745167 missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128779051 splice site probably benign
R0360:Sec23ip UTSW 7 128761405 splice site probably benign
R1442:Sec23ip UTSW 7 128776786 missense probably benign 0.10
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1564:Sec23ip UTSW 7 128766281 splice site probably null
R1876:Sec23ip UTSW 7 128752851 missense probably benign
R1966:Sec23ip UTSW 7 128755353 missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128766273 missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128762461 missense probably benign 0.00
R2847:Sec23ip UTSW 7 128754073 missense probably benign 0.00
R3958:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3959:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3960:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R4287:Sec23ip UTSW 7 128777333 missense probably benign 0.37
R4510:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128750502 nonsense probably null
R4660:Sec23ip UTSW 7 128750286 missense probably null 0.00
R4890:Sec23ip UTSW 7 128752910 missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128766136 missense probably benign
R5587:Sec23ip UTSW 7 128750427 missense probably benign
R5625:Sec23ip UTSW 7 128744983 unclassified probably benign
R5656:Sec23ip UTSW 7 128776784 missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128772184 missense probably benign 0.00
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128778484 missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128752849 synonymous silent
R6953:Sec23ip UTSW 7 128752796 nonsense probably null
R6992:Sec23ip UTSW 7 128765440 missense probably benign
R7131:Sec23ip UTSW 7 128779640 missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128762533 critical splice donor site probably null
R7387:Sec23ip UTSW 7 128745003 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTCAGCTCACAGCAGCCAC -3'
(R):5'- GCCAGAGAGTGACATTTCCACACC -3'

Sequencing Primer
(F):5'- CATGCTTGGGAGCCAGTG -3'
(R):5'- GCAGAGCAACTAACCTGTTTCTC -3'
Posted On2014-03-14