Incidental Mutation 'R1427:Abhd12b'
ID161364
Institutional Source Beutler Lab
Gene Symbol Abhd12b
Ensembl Gene ENSMUSG00000090121
Gene Nameabhydrolase domain containing 12B
SynonymsLOC328121
MMRRC Submission 039483-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R1427 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70154142-70183887 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70182419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 223 (D223G)
Ref Sequence ENSEMBL: ENSMUSP00000138681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169156] [ENSMUST00000182512] [ENSMUST00000182782] [ENSMUST00000182927]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162570
Predicted Effect probably damaging
Transcript: ENSMUST00000169156
AA Change: D300G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134568
Gene: ENSMUSG00000090121
AA Change: D300G

DomainStartEndE-ValueType
Pfam:Hydrolase_4 136 289 1e-16 PFAM
Pfam:Abhydrolase_1 137 278 2.6e-10 PFAM
Pfam:Abhydrolase_5 138 337 3.5e-22 PFAM
Pfam:Abhydrolase_6 139 347 2.1e-12 PFAM
Pfam:Peptidase_S9 154 357 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182512
Predicted Effect probably benign
Transcript: ENSMUST00000182782
Predicted Effect probably damaging
Transcript: ENSMUST00000182927
AA Change: D223G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138681
Gene: ENSMUSG00000090121
AA Change: D223G

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 61 260 1.5e-22 PFAM
Pfam:Abhydrolase_6 62 266 1.8e-19 PFAM
Pfam:Peptidase_S9 77 280 5.1e-8 PFAM
Pfam:Abhydrolase_1 89 279 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,623,040 N289S probably damaging Het
Agap3 A G 5: 24,476,693 T333A probably benign Het
Arhgap28 C A 17: 67,857,464 Q554H probably damaging Het
Clcnkb A G 4: 141,405,309 L603P probably damaging Het
Dchs1 T C 7: 105,766,191 D626G probably benign Het
Eml3 T C 19: 8,933,861 Y285H probably damaging Het
Ganab A G 19: 8,915,666 T945A probably benign Het
Iars A T 13: 49,704,269 probably null Het
Kalrn A G 16: 33,975,754 F1217S probably damaging Het
Lipf T C 19: 33,965,600 F103L probably damaging Het
Lpar2 C A 8: 69,824,050 A163E possibly damaging Het
Myh1 T C 11: 67,219,747 Y1495H probably damaging Het
Olfr487 A G 7: 108,212,094 I145T probably benign Het
Ppp3ca T A 3: 136,921,914 L413H probably damaging Het
Ptpn7 T C 1: 135,134,454 V46A possibly damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sec23ip C T 7: 128,776,885 R808C probably damaging Het
Slc25a26 T C 6: 94,510,847 S96P probably damaging Het
Stard13 G A 5: 151,045,991 R898W probably damaging Het
Tenm4 T C 7: 96,843,048 V1063A probably benign Het
Tm6sf2 T G 8: 70,075,582 M127R probably damaging Het
Ttn A T 2: 76,753,104 W22482R probably damaging Het
Zfp384 T C 6: 125,024,884 L109P probably damaging Het
Other mutations in Abhd12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Abhd12b APN 12 70169048 missense probably damaging 0.99
IGL02886:Abhd12b APN 12 70182966 missense possibly damaging 0.70
ANU23:Abhd12b UTSW 12 70169048 missense probably damaging 0.99
R0112:Abhd12b UTSW 12 70181017 missense probably benign 0.16
R0542:Abhd12b UTSW 12 70163495 missense possibly damaging 0.82
R4782:Abhd12b UTSW 12 70169064 missense probably damaging 1.00
R4799:Abhd12b UTSW 12 70169064 missense probably damaging 1.00
R5238:Abhd12b UTSW 12 70163368 splice site probably null
R5372:Abhd12b UTSW 12 70181026 missense probably damaging 0.98
R6974:Abhd12b UTSW 12 70159447 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAAGGTTTGCACACATGAAGCTG -3'
(R):5'- TCTGTTCCTAAAGCTACCGACCCG -3'

Sequencing Primer
(F):5'- ACACATGAAGCTGTGACTTTTTGG -3'
(R):5'- CCACTCTGGGAAAACCTTGTTAG -3'
Posted On2014-03-14