Incidental Mutation 'R1428:Rps6kc1'
ID161377
Institutional Source Beutler Lab
Gene Symbol Rps6kc1
Ensembl Gene ENSMUSG00000089872
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRPK118
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location190700202-190911770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 190798726 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 936 (T936M)
Ref Sequence ENSEMBL: ENSMUSP00000061769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061611] [ENSMUST00000159367] [ENSMUST00000159624]
Predicted Effect probably damaging
Transcript: ENSMUST00000061611
AA Change: T936M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061769
Gene: ENSMUSG00000089872
AA Change: T936M

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
MIT 235 313 1.12e-20 SMART
low complexity region 317 332 N/A INTRINSIC
SCOP:d1apme_ 347 417 2e-5 SMART
low complexity region 443 454 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Pfam:Pkinase 863 1046 4.4e-26 PFAM
Pfam:Pkinase_Tyr 876 1032 5.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159367
SMART Domains Protein: ENSMUSP00000124383
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
Blast:PX 9 50 4e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159624
SMART Domains Protein: ENSMUSP00000125010
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Pfam:MIT 238 299 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159823
Predicted Effect probably benign
Transcript: ENSMUST00000160889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162500
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Rps6kc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rps6kc1 APN 1 190773678 missense probably damaging 1.00
IGL01310:Rps6kc1 APN 1 190783625 missense probably benign 0.45
IGL01331:Rps6kc1 APN 1 190800352 missense possibly damaging 0.49
IGL01551:Rps6kc1 APN 1 190773640 missense possibly damaging 0.70
IGL01665:Rps6kc1 APN 1 190911657 missense possibly damaging 0.66
IGL02178:Rps6kc1 APN 1 190871836 missense possibly damaging 0.63
IGL02550:Rps6kc1 APN 1 190871862 missense probably damaging 1.00
IGL02986:Rps6kc1 APN 1 190834061 missense probably damaging 1.00
IGL03010:Rps6kc1 APN 1 190911606 nonsense probably null
IGL03087:Rps6kc1 APN 1 190871711 missense probably damaging 1.00
IGL03130:Rps6kc1 APN 1 190799811 missense probably damaging 1.00
IGL03264:Rps6kc1 APN 1 190871829 missense probably benign
IGL03386:Rps6kc1 APN 1 190799570 missense probably damaging 0.97
R0184:Rps6kc1 UTSW 1 190799093 missense probably null 1.00
R0280:Rps6kc1 UTSW 1 190809000 missense probably damaging 1.00
R0482:Rps6kc1 UTSW 1 190799430 missense probably benign 0.00
R0651:Rps6kc1 UTSW 1 190799496 missense possibly damaging 0.51
R0785:Rps6kc1 UTSW 1 190808945 missense probably damaging 1.00
R1398:Rps6kc1 UTSW 1 190800015 missense probably damaging 0.99
R1484:Rps6kc1 UTSW 1 190799475 missense possibly damaging 0.63
R1536:Rps6kc1 UTSW 1 190871768 missense possibly damaging 0.89
R1709:Rps6kc1 UTSW 1 190800336 missense possibly damaging 0.72
R2060:Rps6kc1 UTSW 1 190810108 missense possibly damaging 0.94
R2153:Rps6kc1 UTSW 1 190798723 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R4177:Rps6kc1 UTSW 1 190800419 missense possibly damaging 0.92
R4231:Rps6kc1 UTSW 1 190808900 missense probably damaging 1.00
R4401:Rps6kc1 UTSW 1 190799958 missense probably benign 0.32
R4402:Rps6kc1 UTSW 1 190798605 intron probably benign
R4785:Rps6kc1 UTSW 1 190750188 missense probably benign 0.00
R4810:Rps6kc1 UTSW 1 190808963 missense probably damaging 1.00
R4858:Rps6kc1 UTSW 1 190800318 missense probably damaging 1.00
R4887:Rps6kc1 UTSW 1 190798694 missense probably benign 0.13
R4976:Rps6kc1 UTSW 1 190798727 missense probably damaging 0.99
R5134:Rps6kc1 UTSW 1 190773648 missense probably damaging 1.00
R5217:Rps6kc1 UTSW 1 190783605 missense probably damaging 1.00
R5350:Rps6kc1 UTSW 1 190799466 missense probably benign
R5952:Rps6kc1 UTSW 1 190885420 missense probably benign 0.05
R5979:Rps6kc1 UTSW 1 190800435 missense probably damaging 1.00
R6597:Rps6kc1 UTSW 1 190750184 missense probably benign 0.20
R7024:Rps6kc1 UTSW 1 190800210 missense probably benign 0.00
R7192:Rps6kc1 UTSW 1 190800359 missense probably damaging 0.98
R7423:Rps6kc1 UTSW 1 190799096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCCTTTCTGAGACTTAGTGCTC -3'
(R):5'- ATCAGTGCGGCAAATTCACCCC -3'

Sequencing Primer
(F):5'- CGGATATGCTTAACTATGGATGCC -3'
(R):5'- ATTCACCCCCAGTAATAGCTTC -3'
Posted On2014-03-14