Incidental Mutation 'R1428:Mrc1'
ID161378
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Namemannose receptor, C type 1
SynonymsCD206, MR
MMRRC Submission 039484-MU
Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14229392-14332057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14315263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1003 (T1003S)
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028045
AA Change: T1003S

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: T1003S

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Meta Mutation Damage Score 0.002 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14328425 missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14266524 missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14310084 critical splice donor site probably null
IGL01758:Mrc1 APN 2 14238248 missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14238376 missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14244213 missense probably benign 0.19
IGL02435:Mrc1 APN 2 14248860 nonsense probably null
IGL03073:Mrc1 APN 2 14305342 missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14293478 nonsense probably null
IGL03155:Mrc1 APN 2 14331101 missense probably benign 0.00
IGL03289:Mrc1 APN 2 14308823 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0110:Mrc1 UTSW 2 14238542 splice site probably benign
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14307909 missense probably benign 0.05
R0505:Mrc1 UTSW 2 14310032 missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14270126 splice site probably benign
R0613:Mrc1 UTSW 2 14294819 missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14328571 nonsense probably null
R1122:Mrc1 UTSW 2 14261336 critical splice donor site probably null
R1281:Mrc1 UTSW 2 14293510 missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14279925 missense probably damaging 1.00
R1571:Mrc1 UTSW 2 14308733 missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14248890 missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1733:Mrc1 UTSW 2 14257099 missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1860:Mrc1 UTSW 2 14328579 missense probably benign 0.30
R1872:Mrc1 UTSW 2 14325381 splice site probably null
R1889:Mrc1 UTSW 2 14308677 critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14319241 missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14244292 critical splice donor site probably null
R2031:Mrc1 UTSW 2 14321773 missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14270189 missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14327864 missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14244204 missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14325372 missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14328543 missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14319170 missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14288982 splice site probably benign
R4028:Mrc1 UTSW 2 14238248 missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14293486 missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14270206 missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14319141 missense probably benign 0.01
R4950:Mrc1 UTSW 2 14271280 missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14244189 missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14306516 missense probably benign 0.00
R5279:Mrc1 UTSW 2 14310058 missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14321914 missense probably benign 0.03
R5436:Mrc1 UTSW 2 14266515 missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14279957 missense probably benign 0.05
R5631:Mrc1 UTSW 2 14328572 nonsense probably null
R5831:Mrc1 UTSW 2 14308712 missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14315393 missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14305327 missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14271304 missense probably benign 0.08
R6344:Mrc1 UTSW 2 14244174 missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14270205 missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14307949 missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14294786 splice site probably null
R6631:Mrc1 UTSW 2 14238485 missense probably benign
R6737:Mrc1 UTSW 2 14271277 missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R6887:Mrc1 UTSW 2 14325237 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CGGGACACAACGTTCCCAACTATG -3'
(R):5'- TTCTACTGCTCACTGCCAACGAAG -3'

Sequencing Primer
(F):5'- acgttcccaactatgtgcag -3'
(R):5'- AAACATCCCTCCTCTAAGGTTG -3'
Posted On2014-03-14