Incidental Mutation 'R1428:Olfr1255'
ID161383
Institutional Source Beutler Lab
Gene Symbol Olfr1255
Ensembl Gene ENSMUSG00000045148
Gene Nameolfactory receptor 1255
SynonymsGA_x6K02T2Q125-51257221-51258135, MOR232-4
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89812051-89817860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 89816381 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 12 (L12F)
Ref Sequence ENSEMBL: ENSMUSP00000150299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057369] [ENSMUST00000214508]
Predicted Effect probably damaging
Transcript: ENSMUST00000057369
AA Change: L18F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060602
Gene: ENSMUSG00000045148
AA Change: L18F

DomainStartEndE-ValueType
Pfam:7tm_4 35 309 5.2e-44 PFAM
Pfam:7tm_1 45 291 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214508
AA Change: L12F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Olfr1255
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Olfr1255 APN 2 89816673 missense probably damaging 1.00
IGL02902:Olfr1255 APN 2 89817164 nonsense probably null
IGL03077:Olfr1255 APN 2 89817142 missense probably damaging 1.00
IGL03087:Olfr1255 APN 2 89816671 missense probably damaging 1.00
IGL03371:Olfr1255 APN 2 89817165 missense possibly damaging 0.64
R0683:Olfr1255 UTSW 2 89817178 missense probably damaging 1.00
R1567:Olfr1255 UTSW 2 89817184 missense probably damaging 1.00
R3810:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R3812:Olfr1255 UTSW 2 89817051 missense probably damaging 1.00
R4900:Olfr1255 UTSW 2 89816968 missense possibly damaging 0.58
R5538:Olfr1255 UTSW 2 89816620 missense probably damaging 1.00
R5770:Olfr1255 UTSW 2 89816549 missense probably damaging 1.00
R5894:Olfr1255 UTSW 2 89817213 missense possibly damaging 0.59
R5942:Olfr1255 UTSW 2 89816340 nonsense probably null
R6263:Olfr1255 UTSW 2 89816760 missense probably damaging 1.00
R6271:Olfr1255 UTSW 2 89816562 missense probably damaging 0.99
R6651:Olfr1255 UTSW 2 89816896 missense probably benign 0.13
R7298:Olfr1255 UTSW 2 89816521 missense probably damaging 0.98
R7379:Olfr1255 UTSW 2 89816689 missense probably benign 0.00
R7465:Olfr1255 UTSW 2 89816536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGATCACAATTGCTTCTTTGCCCC -3'
(R):5'- TGCATAGACTTGAGCCATGCATCC -3'

Sequencing Primer
(F):5'- CTTTGCCCCAAGGAAATGTG -3'
(R):5'- TCTTGAAGGGAGTCCGCAATC -3'
Posted On2014-03-14