Incidental Mutation 'R1428:Cyp2j11'
ID161386
Institutional Source Beutler Lab
Gene Symbol Cyp2j11
Ensembl Gene ENSMUSG00000066097
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 11
SynonymsCyp2j11-ps
MMRRC Submission 039484-MU
Accession Numbers

Genbank: NM_001004141; MGI: 2140224

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96294508-96348662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96294880 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 484 (K484E)
Ref Sequence ENSEMBL: ENSMUSP00000132180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015368]
Predicted Effect probably benign
Transcript: ENSMUST00000015368
AA Change: K484E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132180
Gene: ENSMUSG00000066097
AA Change: K484E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 500 4.3e-133 PFAM
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Cyp2j11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Cyp2j11 APN 4 96339095 missense probably benign
IGL01816:Cyp2j11 APN 4 96294924 missense probably damaging 1.00
IGL02406:Cyp2j11 APN 4 96348539 missense possibly damaging 0.56
E7848:Cyp2j11 UTSW 4 96319365 missense probably benign 0.09
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R1298:Cyp2j11 UTSW 4 96307260 critical splice donor site probably null
R1411:Cyp2j11 UTSW 4 96345216 missense probably benign 0.03
R1740:Cyp2j11 UTSW 4 96319376 missense probably benign 0.00
R1818:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1819:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1917:Cyp2j11 UTSW 4 96339974 missense probably damaging 1.00
R2084:Cyp2j11 UTSW 4 96339201 missense probably damaging 1.00
R2146:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2148:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2150:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R4963:Cyp2j11 UTSW 4 96316382 missense probably damaging 1.00
R5335:Cyp2j11 UTSW 4 96307352 missense probably damaging 1.00
R5450:Cyp2j11 UTSW 4 96339876 missense probably benign 0.44
R5688:Cyp2j11 UTSW 4 96345121 missense probably damaging 1.00
R5978:Cyp2j11 UTSW 4 96319352 missense probably damaging 1.00
R6061:Cyp2j11 UTSW 4 96348616 start gained probably benign
R6075:Cyp2j11 UTSW 4 96345085 missense probably benign 0.04
R6912:Cyp2j11 UTSW 4 96294871 missense probably benign 0.00
R7338:Cyp2j11 UTSW 4 96307287 missense possibly damaging 0.64
R7394:Cyp2j11 UTSW 4 96316440 missense probably benign 0.00
R7464:Cyp2j11 UTSW 4 96345120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAATTTAGGCACCAGGAATCC -3'
(R):5'- GAGGTGACTGAGAACAATGGTTCCC -3'

Sequencing Primer
(F):5'- TCTTCAGTATTTCTTGAATCTCCTTC -3'
(R):5'- CCAACGGTCAGAAATATCAATGTGTC -3'
Posted On2014-03-14