Incidental Mutation 'R1428:Atad3a'
ID161388
Institutional Source Beutler Lab
Gene Symbol Atad3a
Ensembl Gene ENSMUSG00000029036
Gene NameATPase family, AAA domain containing 3A
SynonymsTob3, 2400004H09Rik
MMRRC Submission 039484-MU
Accession Numbers

Genbank: NM_179203; MGI:1919214

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155740641-155761093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155755682 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 121 (Q121H)
Ref Sequence ENSEMBL: ENSMUSP00000138808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000176043] [ENSMUST00000184913]
Predicted Effect probably damaging
Transcript: ENSMUST00000030903
AA Change: Q146H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036
AA Change: Q146H

DomainStartEndE-ValueType
Pfam:DUF3523 26 285 9.5e-113 PFAM
AAA 343 482 4.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134317
Predicted Effect unknown
Transcript: ENSMUST00000175679
AA Change: Q21H
Predicted Effect probably damaging
Transcript: ENSMUST00000176043
AA Change: Q146H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135405
Gene: ENSMUSG00000029036
AA Change: Q146H

DomainStartEndE-ValueType
Pfam:DUF3523 20 193 5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184131
Predicted Effect probably damaging
Transcript: ENSMUST00000184913
AA Change: Q121H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138808
Gene: ENSMUSG00000029036
AA Change: Q121H

DomainStartEndE-ValueType
Pfam:DUF3523 1 125 9.9e-43 PFAM
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed mitochondrial membrane protein that contributes to mitochondrial dynamics, nucleoid organization, protein translation, cell growth, and cholesterol metabolism. This gene is a member of the ATPase family AAA-domain containing 3 gene family which, in humans, includes two other paralogs. Naturally occurring mutations in this gene are associated with distinct neurological syndromes including Harel-Yoon syndrome. High-level expression of this gene is associated with poor survival in breast cancer patients. A homozygous knockout of the orthologous gene in mice results in embryonic lethality at day 7.5 due to growth retardation and defective development of the trophoblast lineage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele die around E7.5 exhibiting growth retardation, failure to gastrulate, and impaired development of the trophoblast lineage immediately after implantation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Atad3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Atad3a APN 4 155746078 missense probably damaging 0.98
IGL01982:Atad3a APN 4 155753927 missense possibly damaging 0.94
IGL02059:Atad3a APN 4 155754750 splice site probably benign
IGL02572:Atad3a APN 4 155753584 missense possibly damaging 0.61
IGL03086:Atad3a APN 4 155748670 critical splice donor site probably null
IGL03409:Atad3a APN 4 155747350 missense probably damaging 0.99
E2594:Atad3a UTSW 4 155750933 unclassified probably benign
FR4976:Atad3a UTSW 4 155753939 missense probably damaging 0.98
PIT4618001:Atad3a UTSW 4 155750138 missense probably benign 0.41
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0601:Atad3a UTSW 4 155747407 missense probably damaging 1.00
R0799:Atad3a UTSW 4 155747470 missense probably damaging 1.00
R1597:Atad3a UTSW 4 155751435 critical splice donor site probably null
R2188:Atad3a UTSW 4 155751519 missense probably damaging 0.99
R4126:Atad3a UTSW 4 155754061 splice site probably benign
R4564:Atad3a UTSW 4 155747309 splice site probably null
R5334:Atad3a UTSW 4 155755689 missense probably damaging 1.00
R6354:Atad3a UTSW 4 155753945 missense possibly damaging 0.58
R6481:Atad3a UTSW 4 155753641 splice site probably null
R7220:Atad3a UTSW 4 155754041 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACATCTCTGCCTTTAGGTGCATGTC -3'
(R):5'- AGCGAACAGATCCGTGTGCAAG -3'

Sequencing Primer
(F):5'- TCTGGGCACATCCATCGTG -3'
(R):5'- ATGGACTCCTTGGTACAGAGC -3'
Posted On2014-03-14