Incidental Mutation 'R1428:Plb1'
ID161389
Institutional Source Beutler Lab
Gene Symbol Plb1
Ensembl Gene ENSMUSG00000029134
Gene Namephospholipase B1
Synonyms4930539A06Rik, 4632413E21Rik, 4930433E17Rik
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32232708-32366520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32264912 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 70 (R70G)
Ref Sequence ENSEMBL: ENSMUSP00000144040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202201] [ENSMUST00000202220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101376
AA Change: R70G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: R70G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201313
Predicted Effect possibly damaging
Transcript: ENSMUST00000202201
AA Change: R70G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144401
Gene: ENSMUSG00000029134
AA Change: R70G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202220
AA Change: R70G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: R70G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202886
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
Olfr517 T A 7: 108,868,960 N65Y probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Plb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Plb1 APN 5 32345736 missense probably benign 0.00
IGL00542:Plb1 APN 5 32269834 missense probably benign 0.02
IGL00835:Plb1 APN 5 32364172 missense unknown
IGL00954:Plb1 APN 5 32298514 splice site probably benign
IGL01350:Plb1 APN 5 32317064 missense probably damaging 1.00
IGL01527:Plb1 APN 5 32317123 missense probably damaging 1.00
IGL01599:Plb1 APN 5 32342544 splice site probably benign
IGL01690:Plb1 APN 5 32313697 missense probably damaging 1.00
IGL01813:Plb1 APN 5 32329085 missense probably damaging 1.00
IGL01826:Plb1 APN 5 32281145 missense probably damaging 0.99
IGL02263:Plb1 APN 5 32321348 splice site probably benign
IGL02314:Plb1 APN 5 32281148 missense possibly damaging 0.93
IGL02649:Plb1 APN 5 32362568 missense probably benign 0.09
IGL02701:Plb1 APN 5 32364197 missense unknown
IGL02704:Plb1 APN 5 32353667 missense probably benign 0.03
IGL03170:Plb1 APN 5 32284902 missense probably damaging 0.99
IGL03182:Plb1 APN 5 32344915 splice site probably benign
IGL03326:Plb1 APN 5 32331327 missense probably benign 0.00
IGL03046:Plb1 UTSW 5 32328412 missense probably damaging 1.00
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0330:Plb1 UTSW 5 32355357 missense probably damaging 1.00
R0413:Plb1 UTSW 5 32355362 missense probably damaging 1.00
R0721:Plb1 UTSW 5 32364195 missense unknown
R0735:Plb1 UTSW 5 32284920 missense possibly damaging 0.90
R1423:Plb1 UTSW 5 32293257 missense probably benign
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1694:Plb1 UTSW 5 32317277 missense probably null 0.01
R1801:Plb1 UTSW 5 32293243 missense probably damaging 1.00
R1804:Plb1 UTSW 5 32353697 missense possibly damaging 0.91
R1900:Plb1 UTSW 5 32286847 missense probably benign 0.44
R1903:Plb1 UTSW 5 32291238 missense probably damaging 1.00
R2101:Plb1 UTSW 5 32349660 missense probably damaging 1.00
R2153:Plb1 UTSW 5 32314089 missense probably damaging 1.00
R2207:Plb1 UTSW 5 32316640 missense possibly damaging 0.50
R2270:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2271:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2311:Plb1 UTSW 5 32269818 missense probably benign 0.01
R2850:Plb1 UTSW 5 32293224 missense probably benign
R3103:Plb1 UTSW 5 32328029 missense possibly damaging 0.92
R4444:Plb1 UTSW 5 32330565 missense probably benign 0.06
R4559:Plb1 UTSW 5 32332831 missense probably damaging 0.99
R4577:Plb1 UTSW 5 32247557 nonsense probably null
R4578:Plb1 UTSW 5 32247557 nonsense probably null
R4739:Plb1 UTSW 5 32349679 splice site probably null
R4747:Plb1 UTSW 5 32349659 missense probably benign 0.08
R4806:Plb1 UTSW 5 32289852 missense probably damaging 1.00
R5406:Plb1 UTSW 5 32341915 missense probably damaging 1.00
R5567:Plb1 UTSW 5 32364199 missense unknown
R5574:Plb1 UTSW 5 32329947 missense probably benign 0.13
R5588:Plb1 UTSW 5 32329949 critical splice donor site probably null
R5619:Plb1 UTSW 5 32333497 missense probably damaging 0.99
R5769:Plb1 UTSW 5 32317522 missense probably benign 0.05
R6366:Plb1 UTSW 5 32314085 missense possibly damaging 0.59
R6700:Plb1 UTSW 5 32333464 missense probably damaging 0.99
R7162:Plb1 UTSW 5 32349663 missense probably benign 0.30
R7379:Plb1 UTSW 5 32345639 missense probably damaging 1.00
R7395:Plb1 UTSW 5 32353684 missense probably benign 0.30
X0018:Plb1 UTSW 5 32285883 missense probably benign 0.01
X0019:Plb1 UTSW 5 32353697 missense probably damaging 0.99
X0027:Plb1 UTSW 5 32270358 missense probably benign
X0028:Plb1 UTSW 5 32302675 missense probably damaging 1.00
Z1088:Plb1 UTSW 5 32310847 missense probably damaging 0.99
Z1088:Plb1 UTSW 5 32310917 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTTCCAGGATTCCCAGTAAGTACAG -3'
(R):5'- GGCACATACAATGCTTTCTCCCAAATG -3'

Sequencing Primer
(F):5'- TAGGCATTCTCTGCCTACCT -3'
(R):5'- ccttctgcccccacatc -3'
Posted On2014-03-14