Incidental Mutation 'R1428:Olfr517'
ID161393
Institutional Source Beutler Lab
Gene Symbol Olfr517
Ensembl Gene ENSMUSG00000066240
Gene Nameolfactory receptor 517
SynonymsGA_x6K02T2PBJ9-11199311-11198367, MOR268-4
MMRRC Submission 039484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1428 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108867208-108872379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108868960 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 65 (N65Y)
Ref Sequence ENSEMBL: ENSMUSP00000150980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084753] [ENSMUST00000216500]
Predicted Effect probably damaging
Transcript: ENSMUST00000084753
AA Change: N65Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081805
Gene: ENSMUSG00000066240
AA Change: N65Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.4e-60 PFAM
Pfam:7tm_1 41 299 4.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207346
Predicted Effect probably damaging
Transcript: ENSMUST00000216500
AA Change: N65Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2410089E03Rik T A 15: 8,219,369 Y1801N possibly damaging Het
Abl1 G T 2: 31,801,810 A1114S probably damaging Het
Acbd5 T C 2: 23,099,721 V452A probably damaging Het
Armc12 A G 17: 28,537,936 D225G probably damaging Het
Atad3a T A 4: 155,755,682 Q121H probably damaging Het
Bptf T A 11: 107,073,047 I1711F probably damaging Het
C2cd4c A T 10: 79,612,230 I361N probably damaging Het
Canx A G 11: 50,308,394 probably benign Het
Ccdc127 C T 13: 74,356,915 T194I probably benign Het
Cdc42ep3 T C 17: 79,335,036 K152E probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cnbd2 T C 2: 156,339,284 probably null Het
Crybg1 T C 10: 43,975,078 N1599S probably benign Het
Cyc1 T C 15: 76,344,348 V59A probably benign Het
Cyp2j11 T C 4: 96,294,880 K484E probably benign Het
Ddx60 T C 8: 61,958,159 probably benign Het
Epg5 T C 18: 77,962,427 S711P probably damaging Het
Espl1 A T 15: 102,305,685 Q649L probably benign Het
Eya1 G A 1: 14,304,414 probably benign Het
Fam214a A T 9: 75,006,321 T79S probably benign Het
Fam71e2 T A 7: 4,757,688 H675L possibly damaging Het
Fat2 T A 11: 55,296,087 Y1311F probably damaging Het
Gins4 T C 8: 23,227,128 Y208C probably damaging Het
Gsk3b T C 16: 38,090,575 V17A probably benign Het
Gykl1 A T 18: 52,694,761 K347I probably benign Het
Helz T A 11: 107,592,840 probably benign Het
Hivep3 C T 4: 120,096,575 T696I possibly damaging Het
Ifi27l2a G T 12: 103,442,834 probably benign Het
Kif13a A G 13: 46,791,511 probably benign Het
Kpna3 C T 14: 61,383,220 probably benign Het
Mmp15 C G 8: 95,369,562 P327R probably benign Het
Mrc1 A T 2: 14,315,263 T1003S probably benign Het
Mtss1 T C 15: 58,947,390 D393G probably benign Het
Olfm4 T A 14: 80,021,403 Y331N probably damaging Het
Olfr1255 G C 2: 89,816,381 L12F probably damaging Het
P2rx3 G C 2: 85,024,950 T54R possibly damaging Het
Pacsin1 C T 17: 27,705,963 T217I probably damaging Het
Phlpp1 A G 1: 106,380,425 probably null Het
Pknox1 T C 17: 31,592,092 probably benign Het
Plb1 A G 5: 32,264,912 R70G possibly damaging Het
Rab3gap2 G A 1: 185,247,904 A340T probably damaging Het
Rnf103 T A 6: 71,508,999 W205R probably damaging Het
Rps6kc1 G A 1: 190,798,726 T936M probably damaging Het
Spef2 T C 15: 9,596,707 probably benign Het
Sstr4 A G 2: 148,396,359 S297G probably benign Het
Timm8a1 C T X: 134,538,123 E93K probably benign Het
Uck1 A C 2: 32,258,355 Y150D probably damaging Het
Yipf4 A G 17: 74,498,305 probably benign Het
Other mutations in Olfr517
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Olfr517 APN 7 108868275 missense possibly damaging 0.94
IGL01866:Olfr517 APN 7 108868799 missense possibly damaging 0.95
IGL02131:Olfr517 APN 7 108868208 makesense probably null
IGL02456:Olfr517 APN 7 108869050 missense probably benign 0.19
IGL02604:Olfr517 APN 7 108868650 missense probably benign 0.00
IGL02975:Olfr517 APN 7 108868855 nonsense probably null
R0084:Olfr517 UTSW 7 108868800 missense probably damaging 0.98
R0504:Olfr517 UTSW 7 108868850 missense possibly damaging 0.91
R0748:Olfr517 UTSW 7 108869150 start codon destroyed probably null 1.00
R1907:Olfr517 UTSW 7 108868498 missense possibly damaging 0.78
R2292:Olfr517 UTSW 7 108869016 missense probably benign 0.05
R3874:Olfr517 UTSW 7 108869128 missense probably damaging 0.98
R4091:Olfr517 UTSW 7 108868443 missense probably damaging 1.00
R4873:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R4875:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R5440:Olfr517 UTSW 7 108868626 missense probably damaging 1.00
R5920:Olfr517 UTSW 7 108868688 missense probably benign
R6723:Olfr517 UTSW 7 108868588 missense probably damaging 1.00
R6730:Olfr517 UTSW 7 108868573 missense probably benign 0.09
R6892:Olfr517 UTSW 7 108868515 missense probably damaging 1.00
R7473:Olfr517 UTSW 7 108868269 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAATCGATCATAAGCCATTGCCC -3'
(R):5'- TTCAAGTGAATGGAAGCTAGAGCCG -3'

Sequencing Primer
(F):5'- GCCATTGCCCCCAAGAG -3'
(R):5'- CTGTGTTCCTAAGAATGACCCAGG -3'
Posted On2014-03-14