Incidental Mutation 'R1429:Phc2'
ID161433
Institutional Source Beutler Lab
Gene Symbol Phc2
Ensembl Gene ENSMUSG00000028796
Gene Namepolyhomeotic 2
SynonymsEdr2, D4Ertd810e, Mph2, D130050K19Rik
MMRRC Submission 039485-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1429 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location128654702-128752881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128743555 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 51 (P51Q)
Ref Sequence ENSEMBL: ENSMUSP00000123307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030588] [ENSMUST00000106079] [ENSMUST00000106080] [ENSMUST00000120946] [ENSMUST00000133439] [ENSMUST00000134421] [ENSMUST00000138445] [ENSMUST00000143632] [ENSMUST00000147572]
Predicted Effect probably damaging
Transcript: ENSMUST00000030588
AA Change: P578Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030588
Gene: ENSMUSG00000028796
AA Change: P578Q

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 662 781 2.6e-55 PFAM
SAM 783 850 8.53e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106079
AA Change: P51Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101689
Gene: ENSMUSG00000028796
AA Change: P51Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 1e-6 PDB
low complexity region 216 228 N/A INTRINSIC
SAM 256 323 8.53e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106080
AA Change: P578Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101690
Gene: ENSMUSG00000028796
AA Change: P578Q

DomainStartEndE-ValueType
low complexity region 15 41 N/A INTRINSIC
low complexity region 74 119 N/A INTRINSIC
low complexity region 126 152 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
low complexity region 343 367 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
low complexity region 529 543 N/A INTRINSIC
PDB:2L8E|A 632 662 4e-7 PDB
low complexity region 743 755 N/A INTRINSIC
SAM 783 850 8.53e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120946
Predicted Effect unknown
Transcript: ENSMUST00000133439
AA Change: P51Q
SMART Domains Protein: ENSMUSP00000117163
Gene: ENSMUSG00000028796
AA Change: P51Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134421
AA Change: P51Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123307
Gene: ENSMUSG00000028796
AA Change: P51Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 6e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138445
Predicted Effect probably benign
Transcript: ENSMUST00000143632
Predicted Effect possibly damaging
Transcript: ENSMUST00000147572
AA Change: P51Q

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118298
Gene: ENSMUSG00000028796
AA Change: P51Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:2L8E|A 105 135 8e-7 PDB
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele have normal skulls but exhibit posterior homeotic transformations of the axial skeleton. Cultured mouse embryonic fibroblasts show defects in proliferation and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Alg8 C T 7: 97,390,292 A410V probably benign Het
Arhgef4 A G 1: 34,810,339 Y481C probably damaging Het
Armc8 A G 9: 99,536,207 V56A possibly damaging Het
Cactin T C 10: 81,323,678 I23T probably damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cfap54 T C 10: 92,821,038 I3051V probably benign Het
Cpxm1 A T 2: 130,396,444 I66N probably damaging Het
Ddx50 G A 10: 62,647,068 T74I possibly damaging Het
Dgcr14 G A 16: 17,902,205 R427* probably null Het
Dnah7b G T 1: 46,289,656 D3183Y possibly damaging Het
Dsg1b A G 18: 20,390,195 D93G probably damaging Het
Fam135a T G 1: 24,044,267 K292N probably damaging Het
Fam83b G T 9: 76,492,577 R415S probably benign Het
Fxyd3 T A 7: 31,073,621 M1L probably benign Het
Gm5134 T A 10: 75,978,381 M193K probably damaging Het
Golgb1 A G 16: 36,900,563 E427G possibly damaging Het
Gpat3 G A 5: 100,893,087 G338S probably damaging Het
Hmgxb3 C T 18: 61,150,433 R606Q probably damaging Het
Itgb1 T C 8: 128,717,676 probably null Het
Myh1 C A 11: 67,217,910 T1384K possibly damaging Het
Myo3b A C 2: 70,253,007 Q640P probably damaging Het
Naa16 A G 14: 79,359,527 V305A probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pgap1 T C 1: 54,494,861 D631G probably benign Het
Pmel G A 10: 128,718,992 probably null Het
Rassf8 G T 6: 145,815,190 G81W probably damaging Het
Rfx2 G T 17: 56,804,369 Q68K probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsbn1l A G 5: 20,920,018 L262S probably damaging Het
S100a16 A C 3: 90,542,084 Y22S probably damaging Het
Stx19 G A 16: 62,822,597 V259I possibly damaging Het
Tas2r105 T C 6: 131,686,941 I175V probably benign Het
Vmn2r67 T A 7: 85,152,823 H90L possibly damaging Het
Wscd1 T A 11: 71,760,174 L109Q probably damaging Het
Zfp423 T A 8: 87,686,442 Q1154L probably damaging Het
Zmym6 T C 4: 127,123,879 L1059P probably damaging Het
Other mutations in Phc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Phc2 APN 4 128745844 missense probably damaging 1.00
IGL01470:Phc2 APN 4 128723110 missense probably benign 0.00
IGL02171:Phc2 APN 4 128711065 missense probably damaging 1.00
IGL02884:Phc2 APN 4 128708016 missense probably damaging 1.00
I1329:Phc2 UTSW 4 128711113 missense probably damaging 0.98
PIT4696001:Phc2 UTSW 4 128705202 missense probably damaging 1.00
R0483:Phc2 UTSW 4 128723307 unclassified probably benign
R0625:Phc2 UTSW 4 128723710 missense possibly damaging 0.80
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1392:Phc2 UTSW 4 128745087 missense possibly damaging 0.63
R1701:Phc2 UTSW 4 128751607 missense probably damaging 1.00
R1820:Phc2 UTSW 4 128743543 missense probably damaging 0.99
R2011:Phc2 UTSW 4 128723585 missense probably benign 0.27
R2063:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2064:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2065:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2066:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2067:Phc2 UTSW 4 128747136 missense probably damaging 1.00
R2152:Phc2 UTSW 4 128745066 makesense probably null
R2375:Phc2 UTSW 4 128723025 missense probably benign
R2430:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R3910:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3911:Phc2 UTSW 4 128743558 critical splice donor site probably null
R3941:Phc2 UTSW 4 128747244 critical splice donor site probably null
R4108:Phc2 UTSW 4 128707983 missense probably damaging 1.00
R4585:Phc2 UTSW 4 128743510 missense probably damaging 1.00
R4731:Phc2 UTSW 4 128707971 missense probably damaging 1.00
R4801:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4802:Phc2 UTSW 4 128751598 missense probably damaging 1.00
R4948:Phc2 UTSW 4 128723115 missense probably benign 0.00
R5498:Phc2 UTSW 4 128708994 missense probably benign 0.37
R5712:Phc2 UTSW 4 128745095 missense probably damaging 1.00
R5742:Phc2 UTSW 4 128745868 missense probably damaging 1.00
R6272:Phc2 UTSW 4 128709647 missense probably damaging 1.00
R6298:Phc2 UTSW 4 128748189 missense possibly damaging 0.91
R6348:Phc2 UTSW 4 128705151 missense probably benign 0.00
R6630:Phc2 UTSW 4 128723630 missense probably damaging 0.97
R6925:Phc2 UTSW 4 128748134 missense probably damaging 1.00
R7067:Phc2 UTSW 4 128747141 missense probably benign 0.02
R7396:Phc2 UTSW 4 128748161 missense probably benign 0.21
X0012:Phc2 UTSW 4 128709052 missense probably damaging 0.99
X0017:Phc2 UTSW 4 128723272 missense probably damaging 0.99
X0023:Phc2 UTSW 4 128708043 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCATTGTTCATGCACTGACCGACC -3'
(R):5'- ACATCTCAGATCGTACTCCCATGCC -3'

Sequencing Primer
(F):5'- TGACCGACCTCAGCAGC -3'
(R):5'- CAAGGGAAGAACAAACTGTTCAC -3'
Posted On2014-03-14