Incidental Mutation 'R1429:Fxyd3'
ID161438
Institutional Source Beutler Lab
Gene Symbol Fxyd3
Ensembl Gene ENSMUSG00000057092
Gene NameFXYD domain-containing ion transport regulator 3
SynonymsMat8
MMRRC Submission 039485-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1429 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location31068172-31076704 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 31073621 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000130245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039775] [ENSMUST00000072331] [ENSMUST00000167369] [ENSMUST00000171359]
Predicted Effect probably benign
Transcript: ENSMUST00000039775
SMART Domains Protein: ENSMUSP00000041579
Gene: ENSMUSG00000036560

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
LRR 75 98 7.17e1 SMART
LRR 99 122 2.76e1 SMART
LRR_TYP 123 146 2.43e-4 SMART
LRRCT 158 207 3.97e-5 SMART
Pfam:EPTP 214 251 1.1e-7 PFAM
Pfam:EPTP 396 438 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072331
Predicted Effect probably benign
Transcript: ENSMUST00000072331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165862
Predicted Effect probably benign
Transcript: ENSMUST00000167369
AA Change: M1L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130245
Gene: ENSMUSG00000057092
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 25 71 5.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170456
Predicted Effect probably benign
Transcript: ENSMUST00000171359
AA Change: M1L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128610
Gene: ENSMUSG00000057092
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ATP1G1_PLM_MAT8 23 72 4.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186929
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The encoded protein is a transmembrane protein that functions as a specific regulator of Na,K-ATPase. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Alg8 C T 7: 97,390,292 A410V probably benign Het
Arhgef4 A G 1: 34,810,339 Y481C probably damaging Het
Armc8 A G 9: 99,536,207 V56A possibly damaging Het
Cactin T C 10: 81,323,678 I23T probably damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cfap54 T C 10: 92,821,038 I3051V probably benign Het
Cpxm1 A T 2: 130,396,444 I66N probably damaging Het
Ddx50 G A 10: 62,647,068 T74I possibly damaging Het
Dgcr14 G A 16: 17,902,205 R427* probably null Het
Dnah7b G T 1: 46,289,656 D3183Y possibly damaging Het
Dsg1b A G 18: 20,390,195 D93G probably damaging Het
Fam135a T G 1: 24,044,267 K292N probably damaging Het
Fam83b G T 9: 76,492,577 R415S probably benign Het
Gm5134 T A 10: 75,978,381 M193K probably damaging Het
Golgb1 A G 16: 36,900,563 E427G possibly damaging Het
Gpat3 G A 5: 100,893,087 G338S probably damaging Het
Hmgxb3 C T 18: 61,150,433 R606Q probably damaging Het
Itgb1 T C 8: 128,717,676 probably null Het
Myh1 C A 11: 67,217,910 T1384K possibly damaging Het
Myo3b A C 2: 70,253,007 Q640P probably damaging Het
Naa16 A G 14: 79,359,527 V305A probably benign Het
Olfr183 G A 16: 59,000,138 G151D possibly damaging Het
Pgap1 T C 1: 54,494,861 D631G probably benign Het
Phc2 C A 4: 128,743,555 P51Q probably damaging Het
Pmel G A 10: 128,718,992 probably null Het
Rassf8 G T 6: 145,815,190 G81W probably damaging Het
Rfx2 G T 17: 56,804,369 Q68K probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsbn1l A G 5: 20,920,018 L262S probably damaging Het
S100a16 A C 3: 90,542,084 Y22S probably damaging Het
Stx19 G A 16: 62,822,597 V259I possibly damaging Het
Tas2r105 T C 6: 131,686,941 I175V probably benign Het
Vmn2r67 T A 7: 85,152,823 H90L possibly damaging Het
Wscd1 T A 11: 71,760,174 L109Q probably damaging Het
Zfp423 T A 8: 87,686,442 Q1154L probably damaging Het
Zmym6 T C 4: 127,123,879 L1059P probably damaging Het
Other mutations in Fxyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Fxyd3 APN 7 31070893 splice site probably benign
PIT4431001:Fxyd3 UTSW 7 31071355 missense probably damaging 1.00
R0267:Fxyd3 UTSW 7 31070734 unclassified probably benign
R1120:Fxyd3 UTSW 7 31071378 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GACTGAGCCTTTTGCTTGTTGTCAC -3'
(R):5'- AATGGCCTCTTTGCACATAGGACC -3'

Sequencing Primer
(F):5'- CACTGATGATTAAATGGCATTTCCCC -3'
(R):5'- TCATGGAACCTGAATGCTCAC -3'
Posted On2014-03-14