Incidental Mutation 'R1430:Slc35e1'
ID161483
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission 039486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1430 (G1)
Quality Score116
Status Validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 72492571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141352
SMART Domains Protein: ENSMUSP00000122215
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:EamA 5 58 1.5e-6 PFAM
Pfam:UAA 6 214 4e-8 PFAM
Pfam:TPT 67 211 1.7e-38 PFAM
Pfam:EamA 76 211 1.4e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152080
AA Change: T6A
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: T6A

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212699
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,714,271 probably benign Het
Aoc2 A G 11: 101,326,495 Y468C probably damaging Het
Cdyl2 A G 8: 116,579,317 probably benign Het
Cfh A G 1: 140,102,698 probably benign Het
Cyp2j9 G T 4: 96,583,964 probably benign Het
Dapk1 T G 13: 60,754,143 F929V probably benign Het
Dhx9 A T 1: 153,483,747 M35K probably benign Het
Dnah5 G A 15: 28,345,857 E2448K probably benign Het
Doc2b A T 11: 75,780,155 C217S possibly damaging Het
Dock11 A G X: 36,069,912 I2010V probably benign Het
Dram1 T C 10: 88,324,779 T227A possibly damaging Het
Eppin G A 2: 164,589,403 T101M probably damaging Het
F13a1 T C 13: 36,898,131 D533G probably damaging Het
Fmo1 C A 1: 162,839,724 R174L probably damaging Het
Fsip2 C A 2: 82,998,063 L6735I possibly damaging Het
Gab1 G T 8: 80,788,612 T359K probably benign Het
Ggta1 T C 2: 35,408,017 D118G possibly damaging Het
Gramd1a A G 7: 31,132,786 S609P probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrrc24 G T 15: 76,723,792 probably null Het
Mak C A 13: 41,070,284 probably benign Het
Megf8 G A 7: 25,364,343 R2708Q possibly damaging Het
Mettl24 T C 10: 40,737,795 C177R probably damaging Het
Mgam G C 6: 40,756,371 E812D probably benign Het
Mroh8 T C 2: 157,269,525 R170G possibly damaging Het
Msn G A X: 96,152,719 V130I probably benign Het
Ncoa4 G A 14: 32,176,722 V500I probably benign Het
Olfr10 A G 11: 49,318,101 probably null Het
Olfr1087 T C 2: 86,690,522 Y151C possibly damaging Het
Olfr1440 C T 19: 12,394,437 T58I probably benign Het
Olfr170 A G 16: 19,606,002 L222P probably damaging Het
Ppm1h T C 10: 122,857,099 S302P probably damaging Het
Prkce T A 17: 86,559,137 probably benign Het
Psenen T C 7: 30,562,390 I34V probably benign Het
Rbl1 T C 2: 157,169,906 T710A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Slc1a5 A G 7: 16,782,403 D168G probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Syce1 A T 7: 140,779,438 probably benign Het
Tbc1d23 G T 16: 57,214,210 D75E probably damaging Het
Tbk1 A G 10: 121,559,934 V418A probably benign Het
Tmem132e T C 11: 82,438,296 V467A probably damaging Het
Tmem241 T C 18: 11,993,594 D144G probably benign Het
Tsc2 A G 17: 24,599,023 probably null Het
Ubxn4 T A 1: 128,274,880 F420I probably benign Het
Usp34 A G 11: 23,459,151 T2645A probably damaging Het
Utp14b A G 1: 78,666,394 K670E probably benign Het
Zfp407 C T 18: 84,209,455 V2010M probably benign Het
Zfp879 A G 11: 50,833,957 F91L probably benign Het
Zfyve26 A G 12: 79,282,817 S532P probably benign Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0566:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1051:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1245:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1343:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
R7309:Slc35e1 UTSW 8 72492514 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCGCTCAAAATCACCTTGTTGACC -3'
(R):5'- AGGGGAAATTGACACCTACCGCAC -3'

Sequencing Primer
(F):5'- AAATCACCTTGTTGACCACGTTAC -3'
(R):5'- GCGTAGTCCAGAGGATTTACC -3'
Posted On2014-03-14