Incidental Mutation 'R1442:Ubr5'
ID161565
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 039497-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 38014924 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably benign
Transcript: ENSMUST00000110336
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
Predicted Effect probably benign
Transcript: ENSMUST00000227143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228504
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Irf7 T C 7: 141,264,022 T246A probably damaging Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense not run
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTGGGGATTACAGGTGGGAAGT -3'
(R):5'- CAGTATCTCGTGAATCTGGAGCAAGC -3'

Sequencing Primer
(F):5'- gctgcctgctctaaagtcc -3'
(R):5'- ACGTTCATCAGCCACAGATG -3'
Posted On2014-03-14