Incidental Mutation 'R1451:Olfr1414'
ID161646
Institutional Source Beutler Lab
Gene Symbol Olfr1414
Ensembl Gene ENSMUSG00000042849
Gene Nameolfactory receptor 1414
SynonymsGA_x6K02T2R7CC-81245243-81246181, MOR103-2
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92506366-92518661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92511795 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 78 (I78F)
Ref Sequence ENSEMBL: ENSMUSP00000140956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062353] [ENSMUST00000189174]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062353
AA Change: I78F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054752
Gene: ENSMUSG00000042849
AA Change: I78F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.7e-52 PFAM
Pfam:7tm_1 41 290 5.7e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188197
AA Change: I78F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139693
Gene: ENSMUSG00000042849
AA Change: I78F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:7tm_1 41 233 1.6e-23 PFAM
Pfam:7tm_4 139 234 1.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189174
AA Change: I78F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140956
Gene: ENSMUSG00000042849
AA Change: I78F

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:7tm_1 41 290 4.2e-25 PFAM
Pfam:7tm_4 139 283 4.3e-42 PFAM
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Olfr1414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Olfr1414 APN 1 92511252 missense probably damaging 1.00
IGL01951:Olfr1414 APN 1 92511131 missense probably null 0.00
IGL02748:Olfr1414 APN 1 92511467 missense probably damaging 1.00
R1926:Olfr1414 UTSW 1 92511608 missense probably damaging 0.98
R1978:Olfr1414 UTSW 1 92511777 missense probably damaging 1.00
R2507:Olfr1414 UTSW 1 92511378 missense probably damaging 1.00
R4820:Olfr1414 UTSW 1 92511090 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTCAAGACATTGGAGCCACAGAAGG -3'
(R):5'- ACAGTCTATTTCCAAGCCCAGCATC -3'

Sequencing Primer
(F):5'- GTAGACCTTAATCACAGAGATGCTG -3'
(R):5'- AAGGTCAGCACCTTCATCCTG -3'
Posted On2014-03-14