Incidental Mutation 'R1451:Sppl3'
ID161653
Institutional Source Beutler Lab
Gene Symbol Sppl3
Ensembl Gene ENSMUSG00000029550
Gene Namesignal peptide peptidase 3
SynonymsUsmg3, 4833416I09Rik
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115011137-115098790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115088365 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 193 (L193P)
Ref Sequence ENSEMBL: ENSMUSP00000031530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031530] [ENSMUST00000128590]
Predicted Effect probably damaging
Transcript: ENSMUST00000031530
AA Change: L193P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031530
Gene: ENSMUSG00000029550
AA Change: L193P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PSN 64 361 1.96e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128590
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit growth retardation, decreased fertility and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Sppl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Sppl3 APN 5 115074876 missense probably benign
IGL02302:Sppl3 APN 5 115082331 missense probably benign 0.43
IGL02381:Sppl3 APN 5 115074910 splice site probably null
IGL02592:Sppl3 APN 5 115095911 missense probably damaging 1.00
IGL02963:Sppl3 APN 5 115061603 missense probably damaging 1.00
R0119:Sppl3 UTSW 5 115088994 unclassified probably benign
R0299:Sppl3 UTSW 5 115088994 unclassified probably benign
R0827:Sppl3 UTSW 5 115082333 nonsense probably null
R1141:Sppl3 UTSW 5 115088293 frame shift probably null
R1321:Sppl3 UTSW 5 115088293 frame shift probably null
R1322:Sppl3 UTSW 5 115088293 frame shift probably null
R3110:Sppl3 UTSW 5 115074864 missense possibly damaging 0.78
R3112:Sppl3 UTSW 5 115074864 missense possibly damaging 0.78
R4701:Sppl3 UTSW 5 115103313 unclassified probably null
R4808:Sppl3 UTSW 5 115083426 splice site probably benign
R4931:Sppl3 UTSW 5 115082314 missense probably damaging 1.00
R6513:Sppl3 UTSW 5 115095936 missense probably damaging 1.00
R6993:Sppl3 UTSW 5 115082290 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATGCTGTGACCTACCTCACACC -3'
(R):5'- GCCAGGATGCCCATACATGACTAAG -3'

Sequencing Primer
(F):5'- TGGGCTGCCCAGTAGAAAC -3'
(R):5'- TGCCCATACATGACTAAGACCTG -3'
Posted On2014-03-14