Incidental Mutation 'R1451:Ccdc136'
ID161655
Institutional Source Beutler Lab
Gene Symbol Ccdc136
Ensembl Gene ENSMUSG00000029769
Gene Namecoiled-coil domain containing 136
Synonyms4921511K06Rik
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1451 (G1)
Quality Score128
Status Validated
Chromosome6
Chromosomal Location29396309-29426994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29419377 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 965 (N965K)
Ref Sequence ENSEMBL: ENSMUSP00000137673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096084] [ENSMUST00000115275] [ENSMUST00000145310] [ENSMUST00000154619] [ENSMUST00000180829] [ENSMUST00000181464] [ENSMUST00000202726]
Predicted Effect probably benign
Transcript: ENSMUST00000096084
AA Change: N1057K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093789
Gene: ENSMUSG00000029769
AA Change: N1057K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 7.26e-6 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 8.87e-9 PROSPERO
internal_repeat_1 819 838 8.87e-9 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 7.26e-6 PROSPERO
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
coiled coil region 1066 1104 N/A INTRINSIC
low complexity region 1108 1142 N/A INTRINSIC
transmembrane domain 1154 1176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115275
SMART Domains Protein: ENSMUSP00000110930
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 1.72e-5 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 2.93e-8 PROSPERO
internal_repeat_1 819 838 2.93e-8 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 1.72e-5 PROSPERO
transmembrane domain 967 989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143599
Predicted Effect probably benign
Transcript: ENSMUST00000145310
SMART Domains Protein: ENSMUSP00000145331
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154619
AA Change: N899K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118132
Gene: ENSMUSG00000029769
AA Change: N899K

DomainStartEndE-ValueType
coiled coil region 1 152 N/A INTRINSIC
coiled coil region 185 250 N/A INTRINSIC
internal_repeat_2 258 277 4.68e-6 PROSPERO
low complexity region 281 295 N/A INTRINSIC
coiled coil region 305 331 N/A INTRINSIC
coiled coil region 368 453 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
coiled coil region 572 621 N/A INTRINSIC
internal_repeat_1 633 652 5.47e-9 PROSPERO
internal_repeat_1 661 680 5.47e-9 PROSPERO
low complexity region 689 710 N/A INTRINSIC
internal_repeat_2 744 763 4.68e-6 PROSPERO
low complexity region 836 853 N/A INTRINSIC
low complexity region 865 883 N/A INTRINSIC
coiled coil region 908 946 N/A INTRINSIC
low complexity region 950 984 N/A INTRINSIC
transmembrane domain 996 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180829
SMART Domains Protein: ENSMUSP00000137747
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 1.21e-5 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.98e-8 PROSPERO
internal_repeat_1 727 746 1.98e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 1.21e-5 PROSPERO
transmembrane domain 875 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181464
AA Change: N965K

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137673
Gene: ENSMUSG00000029769
AA Change: N965K

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 7.68e-6 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.04e-8 PROSPERO
internal_repeat_1 727 746 1.04e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 7.68e-6 PROSPERO
low complexity region 902 919 N/A INTRINSIC
low complexity region 931 949 N/A INTRINSIC
transmembrane domain 969 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202726
SMART Domains Protein: ENSMUSP00000144577
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
coiled coil region 25 90 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Ccdc136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ccdc136 APN 6 29420258 missense probably damaging 0.96
IGL01325:Ccdc136 APN 6 29412950 missense probably benign 0.00
IGL01608:Ccdc136 APN 6 29406114 missense possibly damaging 0.90
IGL02305:Ccdc136 APN 6 29406174 missense probably damaging 1.00
IGL03354:Ccdc136 APN 6 29419103 missense probably damaging 1.00
R0436:Ccdc136 UTSW 6 29414934 missense probably damaging 1.00
R0709:Ccdc136 UTSW 6 29414970 missense possibly damaging 0.64
R1593:Ccdc136 UTSW 6 29415584 missense probably damaging 1.00
R1966:Ccdc136 UTSW 6 29418092 missense probably damaging 1.00
R2113:Ccdc136 UTSW 6 29413032 missense possibly damaging 0.51
R3845:Ccdc136 UTSW 6 29417177 missense probably benign 0.20
R4668:Ccdc136 UTSW 6 29411281 missense probably damaging 0.99
R5037:Ccdc136 UTSW 6 29417123 missense probably damaging 1.00
R5085:Ccdc136 UTSW 6 29419314 missense probably damaging 1.00
R5314:Ccdc136 UTSW 6 29417498 missense probably benign 0.07
R5340:Ccdc136 UTSW 6 29411860 missense possibly damaging 0.84
R5702:Ccdc136 UTSW 6 29412982 missense probably damaging 0.99
R6108:Ccdc136 UTSW 6 29412450 missense probably benign 0.03
R6313:Ccdc136 UTSW 6 29410205 missense probably damaging 0.99
R6640:Ccdc136 UTSW 6 29412960 missense possibly damaging 0.95
R6765:Ccdc136 UTSW 6 29405941 missense probably benign
X0025:Ccdc136 UTSW 6 29409243 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GGTTTCCTAAGAAAGTCCTGGGCTG -3'
(R):5'- AACTGGTGGGCATTCTCCCCAAAG -3'

Sequencing Primer
(F):5'- TGGATAACTGGAGTCCCACTAC -3'
(R):5'- GCACCCAGGAAAGTGGC -3'
Posted On2014-03-14