Incidental Mutation 'R1451:Epha1'
ID161656
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1451 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42361451 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 730 (M730I)
Ref Sequence ENSEMBL: ENSMUSP00000073099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070635] [ENSMUST00000073387] [ENSMUST00000164375] [ENSMUST00000203401] [ENSMUST00000203652] [ENSMUST00000204357]
PDB Structure
The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000070635
SMART Domains Protein: ENSMUSP00000070427
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073387
AA Change: M730I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: M730I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203290
Predicted Effect probably benign
Transcript: ENSMUST00000203401
SMART Domains Protein: ENSMUSP00000145236
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 168 189 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 312 332 N/A INTRINSIC
LIM 344 397 2.4e-17 SMART
LIM 404 456 7.39e-18 SMART
LIM 464 526 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203652
SMART Domains Protein: ENSMUSP00000145451
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204357
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1840:Epha1 UTSW 6 42363588 missense probably damaging 0.99
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2087:Epha1 UTSW 6 42363568 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4280:Epha1 UTSW 6 42365052 missense probably damaging 1.00
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4371:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4847:Epha1 UTSW 6 42361914 missense possibly damaging 0.88
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGGCTGTGGTGAAGATCCGATG -3'
(R):5'- TGGAAAATGGAGCCCTGGATGC -3'

Sequencing Primer
(F):5'- ATCCGATGGGCAATAGCTTC -3'
(R):5'- ATGCCTTTCTGAAGGTGAGACC -3'
Posted On2014-03-14