Incidental Mutation 'R1451:Pde2a'
ID161667
Institutional Source Beutler Lab
Gene Symbol Pde2a
Ensembl Gene ENSMUSG00000110195
Gene Namephosphodiesterase 2A, cGMP-stimulated
Synonyms
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R1451 (G1)
Quality Score101
Status Validated
Chromosome7
Chromosomal Location101421691-101512827 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 101421991 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 23 (E23*)
Ref Sequence ENSEMBL: ENSMUSP00000147847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000163751] [ENSMUST00000166652] [ENSMUST00000210364] [ENSMUST00000211368]
Predicted Effect probably benign
Transcript: ENSMUST00000084894
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163751
AA Change: E23*
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195
AA Change: E23*

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166652
AA Change: E23*
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195
AA Change: E23*

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210364
AA Change: E23*
Predicted Effect probably null
Transcript: ENSMUST00000211368
AA Change: E23*
Meta Mutation Damage Score 0.664 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E17 and E18; another knock out mutation results in only some animals surviving to weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Pde2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Pde2a APN 7 101484589 nonsense probably null
IGL00731:Pde2a APN 7 101508099 missense probably benign 0.04
IGL00807:Pde2a APN 7 101504412 missense probably damaging 1.00
IGL01339:Pde2a APN 7 101507159 missense probably benign
IGL01503:Pde2a APN 7 101501936 splice site probably benign
IGL01646:Pde2a APN 7 101507711 missense possibly damaging 0.95
IGL01960:Pde2a APN 7 101504740 missense probably benign 0.40
IGL02281:Pde2a APN 7 101481392 missense probably benign 0.34
IGL02318:Pde2a APN 7 101503343 missense possibly damaging 0.79
IGL02479:Pde2a APN 7 101501083 missense probably damaging 1.00
IGL02632:Pde2a APN 7 101504656 missense probably damaging 1.00
IGL02725:Pde2a APN 7 101507218 missense probably null 0.00
IGL02888:Pde2a APN 7 101505069 missense probably damaging 0.98
IGL03027:Pde2a APN 7 101481420 missense probably benign 0.01
IGL03114:Pde2a APN 7 101508683 splice site probably benign
PIT1430001:Pde2a UTSW 7 101451477 splice site probably benign
PIT4131001:Pde2a UTSW 7 101511154 missense probably damaging 0.98
R1170:Pde2a UTSW 7 101484543 missense probably benign 0.00
R1298:Pde2a UTSW 7 101507202 missense probably benign 0.12
R1300:Pde2a UTSW 7 101510404 missense possibly damaging 0.48
R1731:Pde2a UTSW 7 101501660 missense probably damaging 1.00
R1863:Pde2a UTSW 7 101511154 missense probably damaging 1.00
R2258:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2259:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2260:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R4179:Pde2a UTSW 7 101481383 makesense probably null
R4688:Pde2a UTSW 7 101502834 missense probably benign
R4717:Pde2a UTSW 7 101494672 missense probably benign 0.00
R4723:Pde2a UTSW 7 101494618 missense possibly damaging 0.80
R4758:Pde2a UTSW 7 101511499 missense probably damaging 1.00
R4965:Pde2a UTSW 7 101502933 missense probably benign 0.01
R5034:Pde2a UTSW 7 101502024 missense probably benign 0.01
R5219:Pde2a UTSW 7 101504604 missense probably damaging 1.00
R5533:Pde2a UTSW 7 101505980 missense probably damaging 0.97
R6083:Pde2a UTSW 7 101502879 missense possibly damaging 0.93
R6114:Pde2a UTSW 7 101511112 critical splice acceptor site probably null
R6365:Pde2a UTSW 7 101510363 missense probably damaging 1.00
R6372:Pde2a UTSW 7 101481392 missense probably benign 0.34
R6395:Pde2a UTSW 7 101501035 missense probably benign 0.00
R6482:Pde2a UTSW 7 101501037 missense probably benign 0.11
R6492:Pde2a UTSW 7 101500442 missense possibly damaging 0.71
R6971:Pde2a UTSW 7 101510313 nonsense probably null
R7027:Pde2a UTSW 7 101511597 missense probably damaging 1.00
R7082:Pde2a UTSW 7 101508096 missense not run
R7107:Pde2a UTSW 7 101421968 missense not run
R7142:Pde2a UTSW 7 101504650 missense not run
Predicted Primers PCR Primer
(F):5'- GGCAGAGTCAAGAACCAGCCATTG -3'
(R):5'- TGCCAGGCATCACTCCTCTATACAG -3'

Sequencing Primer
(F):5'- AGAACCAGCCATTGCTCTTG -3'
(R):5'- GAGACCCCTAACTAGGTTGC -3'
Posted On2014-03-14