Incidental Mutation 'R1451:Ushbp1'
ID161669
Institutional Source Beutler Lab
Gene Symbol Ushbp1
Ensembl Gene ENSMUSG00000034911
Gene NameUSH1 protein network component harmonin binding protein 1
SynonymsMCC2, 2210404N08Rik
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71384272-71395802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71386019 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 588 (Q588K)
Ref Sequence ENSEMBL: ENSMUSP00000045668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002466] [ENSMUST00000049184] [ENSMUST00000137058] [ENSMUST00000212626]
Predicted Effect probably benign
Transcript: ENSMUST00000002466
SMART Domains Protein: ENSMUSP00000002466
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
ZnF_C4 54 125 1.48e-38 SMART
low complexity region 173 185 N/A INTRINSIC
HOLI 191 351 1.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049184
AA Change: Q588K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045668
Gene: ENSMUSG00000034911
AA Change: Q588K

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
coiled coil region 179 218 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 288 352 1.3e-29 PFAM
Blast:HOLI 467 623 2e-24 BLAST
coiled coil region 628 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124732
SMART Domains Protein: ENSMUSP00000116498
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
ZnF_C4 38 80 4.35e-4 SMART
low complexity region 128 140 N/A INTRINSIC
HOLI 146 254 2.72e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132630
Predicted Effect probably benign
Transcript: ENSMUST00000137058
SMART Domains Protein: ENSMUSP00000121648
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 39 62 N/A INTRINSIC
ZnF_C4 76 118 4.35e-4 SMART
Pfam:Hormone_recep 175 270 9.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212516
Predicted Effect probably benign
Transcript: ENSMUST00000212626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213000
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Ushbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ushbp1 APN 8 71387432 missense probably benign
IGL02511:Ushbp1 APN 8 71390937 missense probably null 0.00
IGL02586:Ushbp1 APN 8 71388750 splice site probably benign
IGL02929:Ushbp1 APN 8 71394476 missense probably damaging 0.99
IGL03127:Ushbp1 APN 8 71394376 missense possibly damaging 0.65
R0012:Ushbp1 UTSW 8 71395040 unclassified probably benign
R0012:Ushbp1 UTSW 8 71395040 unclassified probably benign
R0091:Ushbp1 UTSW 8 71388970 missense possibly damaging 0.65
R0097:Ushbp1 UTSW 8 71390713 missense probably damaging 0.98
R0097:Ushbp1 UTSW 8 71390713 missense probably damaging 0.98
R0242:Ushbp1 UTSW 8 71390118 nonsense probably null
R0242:Ushbp1 UTSW 8 71390118 nonsense probably null
R0276:Ushbp1 UTSW 8 71394649 missense possibly damaging 0.83
R0308:Ushbp1 UTSW 8 71391053 missense probably damaging 0.99
R0471:Ushbp1 UTSW 8 71394377 nonsense probably null
R0726:Ushbp1 UTSW 8 71388747 splice site probably benign
R0894:Ushbp1 UTSW 8 71390224 intron probably null
R1797:Ushbp1 UTSW 8 71388923 missense probably damaging 0.99
R2393:Ushbp1 UTSW 8 71394488 missense probably benign 0.05
R2905:Ushbp1 UTSW 8 71387535 nonsense probably null
R4567:Ushbp1 UTSW 8 71385717 missense probably damaging 0.99
R4717:Ushbp1 UTSW 8 71385669 missense probably damaging 0.99
R4977:Ushbp1 UTSW 8 71395049 critical splice donor site probably null
R5151:Ushbp1 UTSW 8 71395155 missense possibly damaging 0.85
R5584:Ushbp1 UTSW 8 71390979 missense possibly damaging 0.77
R5760:Ushbp1 UTSW 8 71387368 missense probably damaging 0.96
R5769:Ushbp1 UTSW 8 71386219 missense probably benign
R6186:Ushbp1 UTSW 8 71391003 missense possibly damaging 0.91
R6661:Ushbp1 UTSW 8 71390661 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCACAAGCAAACGTGGTCCG -3'
(R):5'- GAATGTGTCCCAGGAACTGTCAGC -3'

Sequencing Primer
(F):5'- ccacctgctgctccaac -3'
(R):5'- AGGAACTGTCAGCGTCCTTG -3'
Posted On2014-03-14