Incidental Mutation 'R1451:Lrriq1'
ID161679
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103202515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000166240
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAACAACTTGCCTGTGCATC -3'
(R):5'- GTCAGAGATCCAGGGATTGCAAAGC -3'

Sequencing Primer
(F):5'- TTTGAGCACTCTGCCAGTGT -3'
(R):5'- TCCAGGGATTGCAAAGCTACTG -3'
Posted On2014-03-14