Incidental Mutation 'R1451:Usp43'
ID161682
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Nameubiquitin specific peptidase 43
Synonyms
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67854523-67922153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67856181 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 895 (H895L)
Ref Sequence ENSEMBL: ENSMUSP00000104317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
Predicted Effect probably benign
Transcript: ENSMUST00000021288
AA Change: H900L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: H900L

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108677
AA Change: H895L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: H895L

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129961
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67891419 missense probably benign 0.08
IGL01536:Usp43 APN 11 67855938 missense probably benign 0.01
IGL01754:Usp43 APN 11 67856181 missense probably benign 0.06
IGL02057:Usp43 APN 11 67856287 missense probably benign 0.02
IGL02638:Usp43 APN 11 67855755 missense probably benign 0.06
IGL03105:Usp43 APN 11 67879976 missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67876489 missense probably damaging 1.00
IGL03380:Usp43 APN 11 67875316 missense possibly damaging 0.67
R0207:Usp43 UTSW 11 67876499 missense probably damaging 1.00
R0308:Usp43 UTSW 11 67880140 missense probably damaging 1.00
R0350:Usp43 UTSW 11 67876498 missense probably damaging 1.00
R0479:Usp43 UTSW 11 67897274 missense possibly damaging 0.96
R1686:Usp43 UTSW 11 67887767 missense probably damaging 0.99
R1750:Usp43 UTSW 11 67879953 missense probably damaging 1.00
R1956:Usp43 UTSW 11 67904333 missense probably damaging 1.00
R2107:Usp43 UTSW 11 67855740 frame shift probably null
R2108:Usp43 UTSW 11 67855740 frame shift probably null
R2112:Usp43 UTSW 11 67921710 missense probably damaging 1.00
R2162:Usp43 UTSW 11 67879969 missense probably damaging 1.00
R2336:Usp43 UTSW 11 67891432 nonsense probably null
R4031:Usp43 UTSW 11 67913833 missense probably damaging 1.00
R4355:Usp43 UTSW 11 67891464 missense probably benign 0.01
R4410:Usp43 UTSW 11 67855890 missense probably benign 0.00
R4479:Usp43 UTSW 11 67856407 missense possibly damaging 0.96
R4569:Usp43 UTSW 11 67875352 nonsense probably null
R4569:Usp43 UTSW 11 67898962 missense probably damaging 1.00
R4737:Usp43 UTSW 11 67855505 missense probably damaging 1.00
R5395:Usp43 UTSW 11 67897358 critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67913883 missense probably damaging 0.99
R5686:Usp43 UTSW 11 67921916 unclassified probably benign
R6106:Usp43 UTSW 11 67879907 missense probably benign 0.00
Z1088:Usp43 UTSW 11 67856040 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AAAGAGTGAATGTCCCCTGTCCCC -3'
(R):5'- CGTTCTACCAGCCAGTCCATTGTG -3'

Sequencing Primer
(F):5'- TGGGCCACTGTCCTTAAAG -3'
(R):5'- AGTCCATTGTGCCGCTC -3'
Posted On2014-03-14