Incidental Mutation 'R1451:Snx13'
ID161686
Institutional Source Beutler Lab
Gene Symbol Snx13
Ensembl Gene ENSMUSG00000020590
Gene Namesorting nexin 13
SynonymsRGS-PX1
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location35047186-35147479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35078984 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 34 (A34T)
Ref Sequence ENSEMBL: ENSMUSP00000152167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048519] [ENSMUST00000163677] [ENSMUST00000221272]
Predicted Effect probably benign
Transcript: ENSMUST00000048519
AA Change: A34T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038430
Gene: ENSMUSG00000020590
AA Change: A34T

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 98 285 9.09e-102 SMART
coiled coil region 293 320 N/A INTRINSIC
RGS 374 514 4.63e-32 SMART
low complexity region 546 562 N/A INTRINSIC
PX 564 677 2.88e-31 SMART
Pfam:Nexin_C 793 903 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163677
AA Change: A34T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130182
Gene: ENSMUSG00000020590
AA Change: A34T

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 34 51 N/A INTRINSIC
PXA 97 284 9.09e-102 SMART
coiled coil region 292 319 N/A INTRINSIC
RGS 373 513 4.63e-32 SMART
low complexity region 545 561 N/A INTRINSIC
PX 563 676 2.88e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221272
AA Change: A34T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222101
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are growth retarded and die at midgestation with defects in neural tube closure, vasculogenesis and placental development. Mutant visceral yolk sac endoderm cells exhibit altered endocytic compartments, abundant autophagic vacuoles and mislocalization of endocytic markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Snx13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snx13 APN 12 35098280 missense probably damaging 1.00
IGL01143:Snx13 APN 12 35132160 missense probably damaging 0.96
IGL01446:Snx13 APN 12 35124480 nonsense probably null
IGL01519:Snx13 APN 12 35138472 unclassified probably benign
IGL01902:Snx13 APN 12 35133307 critical splice acceptor site probably null
IGL01903:Snx13 APN 12 35085969 missense probably benign 0.06
IGL02146:Snx13 APN 12 35101079 missense probably benign 0.00
IGL02175:Snx13 APN 12 35132062 missense possibly damaging 0.83
IGL02197:Snx13 APN 12 35106801 missense probably damaging 1.00
IGL02200:Snx13 APN 12 35086885 missense probably damaging 1.00
IGL02476:Snx13 APN 12 35086941 missense probably damaging 1.00
IGL03171:Snx13 APN 12 35100540 missense probably benign 0.28
jiaozhi UTSW 12 35144220 missense probably damaging 0.98
resistance UTSW 12 35112445 missense probably damaging 1.00
IGL02835:Snx13 UTSW 12 35132127 missense possibly damaging 0.48
P0042:Snx13 UTSW 12 35107542 missense probably damaging 1.00
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0047:Snx13 UTSW 12 35101124 splice site probably benign
R0344:Snx13 UTSW 12 35086900 nonsense probably null
R1240:Snx13 UTSW 12 35091406 missense probably damaging 0.99
R1335:Snx13 UTSW 12 35132124 missense probably benign 0.16
R1617:Snx13 UTSW 12 35086896 missense probably damaging 0.99
R2065:Snx13 UTSW 12 35138066 missense possibly damaging 0.91
R2111:Snx13 UTSW 12 35138085 missense probably damaging 1.00
R2385:Snx13 UTSW 12 35119793 missense probably benign 0.36
R2437:Snx13 UTSW 12 35082927 missense probably benign 0.14
R2511:Snx13 UTSW 12 35138081 missense probably benign 0.13
R2860:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2861:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2862:Snx13 UTSW 12 35138117 missense probably benign 0.45
R2992:Snx13 UTSW 12 35105191 missense probably damaging 1.00
R3938:Snx13 UTSW 12 35144097 missense probably benign 0.10
R4304:Snx13 UTSW 12 35122942 missense probably benign 0.10
R4532:Snx13 UTSW 12 35144220 missense probably damaging 0.98
R4692:Snx13 UTSW 12 35086918 missense possibly damaging 0.82
R4783:Snx13 UTSW 12 35098286 missense probably damaging 1.00
R4914:Snx13 UTSW 12 35132033 missense possibly damaging 0.84
R5309:Snx13 UTSW 12 35144325 nonsense probably null
R5425:Snx13 UTSW 12 35100644 nonsense probably null
R5476:Snx13 UTSW 12 35106820 splice site probably null
R5533:Snx13 UTSW 12 35123026 critical splice donor site probably null
R5564:Snx13 UTSW 12 35124472 missense possibly damaging 0.61
R5572:Snx13 UTSW 12 35103120 missense probably damaging 1.00
R5635:Snx13 UTSW 12 35140171 missense probably benign 0.00
R6018:Snx13 UTSW 12 35047319 start gained probably benign
R6612:Snx13 UTSW 12 35106759 missense probably benign 0.19
R6618:Snx13 UTSW 12 35112445 missense probably damaging 1.00
R6737:Snx13 UTSW 12 35140186 missense probably damaging 0.98
R6964:Snx13 UTSW 12 35119789 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTATCTCTTATCGCAACTTTGTACTACCACT -3'
(R):5'- AGCTGGCCGCAGTTTACCAAT -3'

Sequencing Primer
(F):5'- GGGAAATTAAAACCTTCTGAAAAGTG -3'
(R):5'- GGCCGCAGTTTACCAATAGATAC -3'
Posted On2014-03-14