Incidental Mutation 'R1451:Olfr1364'
ID161689
Institutional Source Beutler Lab
Gene Symbol Olfr1364
Ensembl Gene ENSMUSG00000046016
Gene Nameolfactory receptor 1364
SynonymsGA_x6K02T2QHY8-11663090-11664010, MOR256-13
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21571813-21581759 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 21574287 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 56 (Y56*)
Ref Sequence ENSEMBL: ENSMUSP00000149964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057453] [ENSMUST00000206526] [ENSMUST00000213912]
Predicted Effect probably null
Transcript: ENSMUST00000057453
AA Change: Y56*
SMART Domains Protein: ENSMUSP00000059544
Gene: ENSMUSG00000046016
AA Change: Y56*

DomainStartEndE-ValueType
Pfam:7tm_4 36 314 1.2e-48 PFAM
Pfam:7tm_1 47 296 3.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000206526
AA Change: Y56*
Predicted Effect probably null
Transcript: ENSMUST00000213912
AA Change: Y56*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216898
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Mphosph8 C T 14: 56,668,421 R24C possibly damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Olfr1364
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Olfr1364 APN 13 21574457 unclassified probably null
IGL01925:Olfr1364 APN 13 21574171 missense possibly damaging 0.70
R0540:Olfr1364 UTSW 13 21573778 missense probably benign 0.01
R1268:Olfr1364 UTSW 13 21574328 missense probably benign 0.15
R1572:Olfr1364 UTSW 13 21574310 missense possibly damaging 0.53
R1781:Olfr1364 UTSW 13 21573541 missense probably damaging 0.98
R1927:Olfr1364 UTSW 13 21574256 missense probably benign 0.11
R4611:Olfr1364 UTSW 13 21573574 missense probably damaging 0.98
R4750:Olfr1364 UTSW 13 21573743 missense possibly damaging 0.48
R5493:Olfr1364 UTSW 13 21573872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTGACATCTGCCACATCGAG -3'
(R):5'- ATGCCATGATCAACCAGAGCTGCC -3'

Sequencing Primer
(F):5'- AGGCAGCTTCATGGTCACAG -3'
(R):5'- GCTGCCAGGAACAGTTCATC -3'
Posted On2014-03-14