Incidental Mutation 'R1451:Mphosph8'
ID161691
Institutional Source Beutler Lab
Gene Symbol Mphosph8
Ensembl Gene ENSMUSG00000079184
Gene NameM-phase phosphoprotein 8
Synonyms4930548G07Rik, 1500035L22Rik
MMRRC Submission 039506-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R1451 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56668248-56697430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56668421 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 24 (R24C)
Ref Sequence ENSEMBL: ENSMUSP00000112170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116468]
Predicted Effect possibly damaging
Transcript: ENSMUST00000116468
AA Change: R24C

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112170
Gene: ENSMUSG00000079184
AA Change: R24C

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
CHROMO 58 111 6.2e-13 SMART
low complexity region 152 160 N/A INTRINSIC
coiled coil region 226 256 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
Blast:ANK 563 592 1e-7 BLAST
ANK 598 627 4.43e-2 SMART
ANK 631 660 5.45e-2 SMART
ANK 664 693 1.08e-5 SMART
Blast:ANK 697 726 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211600
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.3%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024G13Rik T C 14: 32,376,631 E83G possibly damaging Het
9530053A07Rik T C 7: 28,137,157 F167S probably damaging Het
Abca9 A G 11: 110,127,447 S1116P probably damaging Het
Abcc12 T A 8: 86,557,693 T296S probably damaging Het
Adarb2 A G 13: 8,339,621 probably benign Het
Arhgef12 C T 9: 42,992,578 probably benign Het
Asah1 A G 8: 41,354,012 probably null Het
C1ra A T 6: 124,521,641 Q431L probably benign Het
C1s2 A T 6: 124,625,494 I580N probably benign Het
Cacna2d4 C T 6: 119,236,824 T68I probably benign Het
Car8 A T 4: 8,189,327 H162Q probably benign Het
Ccdc106 A G 7: 5,059,528 R116G probably damaging Het
Ccdc136 T A 6: 29,419,377 N965K probably benign Het
Cd200r3 A G 16: 44,951,547 E58G possibly damaging Het
Cnksr3 T A 10: 7,126,830 S121C probably null Het
Cog6 T C 3: 53,009,113 M212V possibly damaging Het
Ebna1bp2 C A 4: 118,621,072 probably null Het
Epha1 C A 6: 42,361,451 M730I probably damaging Het
Fscn2 A T 11: 120,362,022 E105V probably damaging Het
Gars T C 6: 55,053,123 probably benign Het
Itgb4 G T 11: 115,990,884 G753V probably damaging Het
Kif23 C T 9: 61,924,802 V634M probably damaging Het
Krt8 T C 15: 101,998,829 Y273C possibly damaging Het
Lgmn A G 12: 102,405,892 probably benign Het
Lrig3 T C 10: 126,010,057 I785T possibly damaging Het
Lrriq1 A G 10: 103,202,515 probably benign Het
Lta4h A G 10: 93,480,728 D491G probably damaging Het
Megf10 A T 18: 57,252,859 S315C probably damaging Het
Neurog2 A G 3: 127,633,841 D38G possibly damaging Het
Olfr1364 A T 13: 21,574,287 Y56* probably null Het
Olfr1414 T A 1: 92,511,795 I78F possibly damaging Het
Olfr150 T A 9: 39,737,316 V167D probably benign Het
Olfr30 C T 11: 58,455,532 R139H probably benign Het
Olfr339 G T 2: 36,421,865 A156S probably benign Het
Olfr914 A T 9: 38,606,938 I158F probably benign Het
Pcdhb17 A T 18: 37,486,936 D593V probably damaging Het
Pde2a G T 7: 101,421,991 E23* probably null Het
Prex2 G A 1: 11,156,259 V749I probably benign Het
Ptchd4 A G 17: 42,502,918 Y570C probably damaging Het
Robo3 C T 9: 37,417,711 R1237K probably benign Het
Slc6a1 C A 6: 114,307,795 Y87* probably null Het
Snx13 G A 12: 35,078,984 A34T probably benign Het
Sppl3 T C 5: 115,088,365 L193P probably damaging Het
Tia1 A T 6: 86,430,339 Y277F probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc2l T C 8: 122,615,395 F127L probably damaging Het
Ushbp1 G T 8: 71,386,019 Q588K possibly damaging Het
Usp43 T A 11: 67,856,181 H895L probably benign Het
Vmn1r179 T A 7: 23,928,850 C155* probably null Het
Vmn2r8 T A 5: 108,798,067 D558V probably damaging Het
Vps13a T C 19: 16,710,864 T860A probably benign Het
Vps50 A G 6: 3,565,628 N522S possibly damaging Het
Zfp180 T C 7: 24,105,218 F354S probably benign Het
Zgpat A G 2: 181,380,191 probably benign Het
Other mutations in Mphosph8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Mphosph8 APN 14 56674443 missense probably benign 0.00
IGL00786:Mphosph8 APN 14 56672544 missense probably benign 0.00
IGL01635:Mphosph8 APN 14 56672546 missense probably damaging 0.99
IGL02104:Mphosph8 APN 14 56674579 missense probably benign 0.02
IGL02387:Mphosph8 APN 14 56695721 missense probably damaging 1.00
IGL02486:Mphosph8 APN 14 56688387 missense possibly damaging 0.80
IGL02547:Mphosph8 APN 14 56672484 missense probably damaging 1.00
IGL02578:Mphosph8 APN 14 56674210 missense probably benign
IGL03247:Mphosph8 APN 14 56678820 critical splice donor site probably null
IGL03377:Mphosph8 APN 14 56693486 missense probably damaging 1.00
R0412:Mphosph8 UTSW 14 56674413 missense probably damaging 0.97
R0647:Mphosph8 UTSW 14 56674405 missense probably benign
R1079:Mphosph8 UTSW 14 56674259 missense probably damaging 1.00
R1486:Mphosph8 UTSW 14 56689039 missense probably damaging 1.00
R1687:Mphosph8 UTSW 14 56672478 missense probably damaging 1.00
R1733:Mphosph8 UTSW 14 56693459 missense probably damaging 1.00
R1809:Mphosph8 UTSW 14 56672452 missense probably damaging 1.00
R1844:Mphosph8 UTSW 14 56697159 missense probably damaging 1.00
R2132:Mphosph8 UTSW 14 56678704 missense probably benign 0.04
R4242:Mphosph8 UTSW 14 56674314 missense probably benign 0.00
R4261:Mphosph8 UTSW 14 56674465 missense probably benign 0.00
R4563:Mphosph8 UTSW 14 56691000 missense probably benign 0.00
R4962:Mphosph8 UTSW 14 56678589 missense probably benign 0.27
R5121:Mphosph8 UTSW 14 56676546 nonsense probably null
R6082:Mphosph8 UTSW 14 56668541 missense probably damaging 1.00
R6224:Mphosph8 UTSW 14 56668353 start codon destroyed probably null
R6455:Mphosph8 UTSW 14 56688486 missense probably damaging 1.00
R7086:Mphosph8 UTSW 14 56668523 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCCGTTCTGTGTGTCAATCC -3'
(R):5'- GCTTCGTCTCTTCTGCCAAAACAAC -3'

Sequencing Primer
(F):5'- TCTGTGTGTCAATCCAGAGC -3'
(R):5'- AAGCTGTTCCAGGCTGTTC -3'
Posted On2014-03-14