Incidental Mutation 'R1455:Stag3'
ID161715
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Namestromal antigen 3
SynonymsSA-2, stromalin 3
MMRRC Submission 039510-MU
Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138280240-138312393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138311735 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1215 (M1215K)
Ref Sequence ENSEMBL: ENSMUSP00000125523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000160849] [ENSMUST00000162245]
Predicted Effect probably benign
Transcript: ENSMUST00000048028
AA Change: M1215K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: M1215K

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect probably benign
Transcript: ENSMUST00000160849
SMART Domains Protein: ENSMUSP00000125376
Gene: ENSMUSG00000036928

DomainStartEndE-ValueType
low complexity region 80 95 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
low complexity region 138 152 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably benign
Transcript: ENSMUST00000162245
AA Change: M1215K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: M1215K

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tet2 A G 3: 133,473,645 V1253A possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138299138 missense probably damaging 1.00
IGL00336:Stag3 APN 5 138297659 missense probably benign 0.42
IGL00514:Stag3 APN 5 138300135 missense probably damaging 1.00
IGL00961:Stag3 APN 5 138298349 missense probably benign 0.01
IGL01923:Stag3 APN 5 138289230 missense probably damaging 1.00
IGL02252:Stag3 APN 5 138302548 missense probably damaging 1.00
IGL02424:Stag3 APN 5 138281985 nonsense probably null
IGL02424:Stag3 APN 5 138291366 missense probably damaging 1.00
IGL02869:Stag3 APN 5 138282693 missense probably damaging 0.96
thor UTSW 5 138301036 critical splice donor site probably null
R0016:Stag3 UTSW 5 138291381 missense possibly damaging 0.50
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R1512:Stag3 UTSW 5 138297985 missense probably benign 0.32
R1530:Stag3 UTSW 5 138297412 missense probably damaging 0.99
R1608:Stag3 UTSW 5 138298639 intron probably null
R1736:Stag3 UTSW 5 138304509 splice site probably benign
R1969:Stag3 UTSW 5 138300138 missense probably damaging 0.99
R2034:Stag3 UTSW 5 138298001 missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138301266 missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138298284 missense probably damaging 1.00
R2411:Stag3 UTSW 5 138283028 splice site probably benign
R3792:Stag3 UTSW 5 138298349 missense probably benign 0.01
R3887:Stag3 UTSW 5 138298839 missense probably damaging 0.99
R4255:Stag3 UTSW 5 138290881 missense probably damaging 0.98
R4777:Stag3 UTSW 5 138309199 unclassified probably benign
R4842:Stag3 UTSW 5 138309365 intron probably null
R4854:Stag3 UTSW 5 138296694 splice site probably null
R5045:Stag3 UTSW 5 138304478 missense probably damaging 1.00
R5631:Stag3 UTSW 5 138295877 missense probably damaging 0.96
R5729:Stag3 UTSW 5 138290223 missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138298838 missense probably damaging 0.99
R6004:Stag3 UTSW 5 138289206 missense probably damaging 1.00
R6172:Stag3 UTSW 5 138299843 missense probably benign 0.41
R6503:Stag3 UTSW 5 138304420 missense probably damaging 0.96
R6545:Stag3 UTSW 5 138298352 missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138301499 missense probably damaging 0.98
R6861:Stag3 UTSW 5 138304707 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGGCCTCTTGTGAAGGCACTAAC -3'
(R):5'- AGCCACATGGTAGTTCTCCCACAC -3'

Sequencing Primer
(F):5'- AGGGCTAGGGTAATCCCATTCTC -3'
(R):5'- ACACGGGCTCCTGAAGAC -3'
Posted On2014-03-14