Incidental Mutation 'R1456:Cers1'
ID161793
Institutional Source Beutler Lab
Gene Symbol Cers1
Ensembl Gene ENSMUSG00000087408
Gene Nameceramide synthase 1
SynonymsCerS1, to, Uog-1, Lass1
MMRRC Submission 039511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R1456 (G1)
Quality Score149
Status Validated
Chromosome8
Chromosomal Location70315775-70331592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70331188 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 262 (E262G)
Ref Sequence ENSEMBL: ENSMUSP00000146749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]
Predicted Effect probably damaging
Transcript: ENSMUST00000046516
AA Change: E262G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045892
Gene: ENSMUSG00000055694
AA Change: E262G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 134 144 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075666
SMART Domains Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
Pfam:UPF1_Zn_bind 116 267 4.1e-78 PFAM
Pfam:ResIII 475 617 1.3e-6 PFAM
Pfam:AAA_11 476 600 4.5e-24 PFAM
Pfam:AAA_30 476 688 5.6e-13 PFAM
Pfam:AAA_19 483 559 3.8e-16 PFAM
Pfam:AAA_11 576 679 7.7e-30 PFAM
Pfam:AAA_12 686 883 3.3e-64 PFAM
low complexity region 995 1001 N/A INTRINSIC
low complexity region 1013 1028 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140239
SMART Domains Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

DomainStartEndE-ValueType
low complexity region 49 68 N/A INTRINSIC
TLC 97 311 1.24e-57 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165819
AA Change: E262G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408
AA Change: E262G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:TGFb_propeptide 33 169 7e-16 PFAM
low complexity region 225 237 N/A INTRINSIC
TGFB 251 357 6.22e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207684
AA Change: E262G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215817
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.9%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene encodes a ceramide synthase enzyme, which catalyzes the synthesis of ceramide, the hydrophobic moiety of sphingolipids. The encoded enzyme synthesizes 18-carbon (C18) ceramide in brain neurons. Mice lacking a functional copy of this gene exhibit impaired cerebellar development, locomotion and motor coordination. This protein is transcribed from a bicistronic mRNA, which also encodes growth differentiation factor 1. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for the spontaneous toppler mutation display reduced body and brain weight, a small cerebellum, progressive tremors, ataxia, impaired balance and seizures, as well as dramatic dendritic changes and severe loss of Purkinje cells, glial changes, and a shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,480,920 probably null Het
4930563D23Rik T A 16: 92,320,665 Y245F probably damaging Het
4932414N04Rik A T 2: 68,716,214 E80V possibly damaging Het
Alkbh3 A G 2: 94,001,419 probably null Het
Ankar A T 1: 72,665,118 Y664N probably benign Het
Arhgap18 T C 10: 26,916,440 I629T probably benign Het
Arhgef28 C T 13: 98,075,002 E158K probably benign Het
Asxl2 C T 12: 3,501,872 H1205Y possibly damaging Het
Birc6 A G 17: 74,609,290 I427V probably benign Het
Camk4 A G 18: 33,129,843 probably benign Het
Ccdc178 A T 18: 22,150,424 D16E possibly damaging Het
Cct6b G T 11: 82,753,620 probably benign Het
Ccz1 A G 5: 144,011,018 probably benign Het
Cdh23 T C 10: 60,487,120 N335S possibly damaging Het
Cemip T A 7: 83,998,510 S121C possibly damaging Het
Clec11a G T 7: 44,306,450 P58T possibly damaging Het
Clec16a T C 16: 10,691,555 I797T probably damaging Het
Col4a1 A C 8: 11,242,829 probably benign Het
Colgalt2 G A 1: 152,484,904 V231I probably damaging Het
D430041D05Rik G T 2: 104,208,083 N1580K probably damaging Het
Dcdc5 A G 2: 106,351,565 noncoding transcript Het
Ddx17 T C 15: 79,530,376 D530G probably benign Het
Dhx9 A T 1: 153,465,695 D601E probably benign Het
Dnah3 A G 7: 120,047,630 Y1059H probably damaging Het
Dtx1 C A 5: 120,710,504 probably benign Het
Egfr A G 11: 16,863,065 S182G probably benign Het
Fads1 A G 19: 10,185,752 N131S probably benign Het
Fancm C T 12: 65,118,351 A1490V possibly damaging Het
Fsd2 C A 7: 81,559,591 E168* probably null Het
Gm20388 T C 8: 122,841,948 probably benign Het
Gm9772 A T 17: 22,007,118 C62S probably damaging Het
H60c C T 10: 3,260,307 A81T possibly damaging Het
Hira T G 16: 18,925,663 S377A probably benign Het
Iffo1 T C 6: 125,145,914 S220P possibly damaging Het
Itih4 A G 14: 30,892,653 M491V probably benign Het
Khdrbs2 T C 1: 32,520,696 R102G possibly damaging Het
Klhdc7a T G 4: 139,965,524 Y704S possibly damaging Het
Klk1b21 G A 7: 44,105,499 V73I probably benign Het
Krt42 G A 11: 100,269,609 A88V probably benign Het
Krt42 C T 11: 100,269,610 A88T probably benign Het
Limk1 G T 5: 134,657,510 D580E probably benign Het
Lipk C T 19: 34,046,785 P323S probably damaging Het
Lipo5 T A 19: 33,465,873 probably benign Het
Llgl2 A G 11: 115,845,499 D166G probably benign Het
Mapk8ip3 A T 17: 24,906,949 N439K probably damaging Het
Mapkbp1 C T 2: 119,973,145 R32W probably damaging Het
Med23 T A 10: 24,903,652 probably benign Het
Mrgprb1 A T 7: 48,448,029 M45K probably damaging Het
Mroh7 G A 4: 106,695,141 probably benign Het
Mrpl27 G A 11: 94,653,833 probably benign Het
Ms4a10 T A 19: 10,964,733 T175S possibly damaging Het
Muc3 T C 5: 137,137,951 H330R probably benign Het
Myo15 A T 11: 60,508,202 I2787F probably damaging Het
Ndst1 A G 18: 60,713,205 C11R possibly damaging Het
Obsl1 C A 1: 75,487,656 G1669* probably null Het
Olfr477 A G 7: 107,990,398 E11G probably benign Het
Olfr784 A T 10: 129,387,783 D50V probably damaging Het
Olfr873 T C 9: 20,300,838 Y214H probably benign Het
Pafah2 T A 4: 134,404,157 I52N probably damaging Het
Pcsk6 A T 7: 66,043,535 I693F possibly damaging Het
Pde4c G T 8: 70,746,613 R228L probably benign Het
Pdzd8 T C 19: 59,300,472 N832S probably benign Het
Plbd1 T A 6: 136,613,816 M451L probably benign Het
Pramef17 G T 4: 143,993,281 D171E probably benign Het
Prom1 T C 5: 44,037,623 D260G probably damaging Het
Ranbp17 A G 11: 33,266,310 S813P probably damaging Het
Scn10a T C 9: 119,691,478 I119V probably benign Het
Sh3pxd2b A G 11: 32,415,967 T353A probably damaging Het
Shq1 A T 6: 100,669,698 probably null Het
Slc22a28 T A 19: 8,071,858 H342L possibly damaging Het
Slco2b1 C T 7: 99,664,907 E9K probably null Het
Specc1l T C 10: 75,246,284 F505L probably damaging Het
Sptan1 G T 2: 29,980,203 probably null Het
St6gal2 A G 17: 55,490,931 probably benign Het
Taok2 T C 7: 126,880,141 I73V probably benign Het
Tax1bp1 C T 6: 52,744,244 T478I probably benign Het
Tbc1d4 A T 14: 101,507,106 N361K probably damaging Het
Tph1 A T 7: 46,647,483 Y429* probably null Het
Tprkb A T 6: 85,924,421 R14W probably damaging Het
Trio A T 15: 27,753,804 probably benign Het
Ttc23 T C 7: 67,667,154 probably benign Het
Vmn1r211 T C 13: 22,852,245 Y84C probably damaging Het
Vmn2r22 C G 6: 123,637,665 G322A possibly damaging Het
Wdr74 A G 19: 8,740,412 Q330R probably benign Het
Wdtc1 C A 4: 133,297,428 S486I possibly damaging Het
Zbtb24 T C 10: 41,464,993 V673A possibly damaging Het
Zfpm2 A T 15: 41,102,481 R655S probably damaging Het
Zkscan5 A G 5: 145,220,988 N694D probably benign Het
Other mutations in Cers1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Cers1 APN 8 70323233 missense probably damaging 1.00
IGL01982:Cers1 APN 8 70323431 missense probably damaging 0.99
IGL02827:Cers1 APN 8 70321527 missense probably damaging 1.00
R1025:Cers1 UTSW 8 70321536 missense probably benign 0.44
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1467:Cers1 UTSW 8 70323169 missense possibly damaging 0.89
R1764:Cers1 UTSW 8 70321491 splice site probably null
R2397:Cers1 UTSW 8 70321536 missense probably benign 0.44
R3107:Cers1 UTSW 8 70322636 missense probably benign 0.30
R3808:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R3809:Cers1 UTSW 8 70330010 missense possibly damaging 0.85
R4789:Cers1 UTSW 8 70323368 missense probably damaging 0.96
R5450:Cers1 UTSW 8 70318297 missense probably damaging 0.99
R5987:Cers1 UTSW 8 70321578 missense possibly damaging 0.78
R6274:Cers1 UTSW 8 70331077 missense probably damaging 1.00
R6535:Cers1 UTSW 8 70330154 missense probably damaging 1.00
R7060:Cers1 UTSW 8 70315905 missense possibly damaging 0.86
R7152:Cers1 UTSW 8 70318251 missense not run
Predicted Primers PCR Primer
(F):5'- TTTGACCTGTCGAATGTGGAGCCC -3'
(R):5'- ATGTCTTCGTAGTGTCGCAGGACC -3'

Sequencing Primer
(F):5'- AGCTAAGCGTGGCACTG -3'
(R):5'- AGGACCACGTTGTCACTATTG -3'
Posted On2014-03-14