Incidental Mutation 'R1458:Gm7534'
ID161863
Institutional Source Beutler Lab
Gene Symbol Gm7534
Ensembl Gene ENSMUSG00000073747
Gene Namepredicted gene 7534
Synonyms
MMRRC Submission 039513-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1458 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134190804-134203004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134196833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000095461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097849]
Predicted Effect probably benign
Transcript: ENSMUST00000097849
AA Change: D467G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747
AA Change: D467G

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
internal_repeat_1 21 111 5.47e-40 PROSPERO
low complexity region 112 143 N/A INTRINSIC
low complexity region 158 177 N/A INTRINSIC
internal_repeat_1 181 271 5.47e-40 PROSPERO
low complexity region 322 334 N/A INTRINSIC
ZP 368 618 3.21e-13 SMART
low complexity region 650 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122228
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Abce1 T C 8: 79,707,235 K63R possibly damaging Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Arhgef12 A G 9: 42,988,998 S860P probably damaging Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cic T C 7: 25,279,737 probably benign Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Mrpl21 A G 19: 3,284,808 Y50C possibly damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pde10a A T 17: 8,964,708 D832V probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Phf20l1 T A 15: 66,604,813 F253Y probably damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Gm7534
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Gm7534 APN 4 134201980 missense probably benign 0.27
IGL03170:Gm7534 APN 4 134193034 missense possibly damaging 0.57
FR4342:Gm7534 UTSW 4 134202631 small insertion probably benign
FR4976:Gm7534 UTSW 4 134202630 small insertion probably benign
R0487:Gm7534 UTSW 4 134202778 missense probably damaging 0.97
R0530:Gm7534 UTSW 4 134202910 missense probably benign
R0553:Gm7534 UTSW 4 134202518 missense possibly damaging 0.85
R1121:Gm7534 UTSW 4 134202937 missense probably benign 0.00
R1748:Gm7534 UTSW 4 134200299 missense probably damaging 1.00
R1748:Gm7534 UTSW 4 134202119 missense possibly damaging 0.57
R1913:Gm7534 UTSW 4 134192675 critical splice donor site probably null
R2029:Gm7534 UTSW 4 134202358 missense possibly damaging 0.87
R2069:Gm7534 UTSW 4 134201941 missense possibly damaging 0.63
R2237:Gm7534 UTSW 4 134202205 missense unknown
R2239:Gm7534 UTSW 4 134202205 missense unknown
R3943:Gm7534 UTSW 4 134200345 missense probably benign 0.15
R4646:Gm7534 UTSW 4 134202148 missense probably benign 0.00
R4673:Gm7534 UTSW 4 134200347 missense probably benign 0.01
R4838:Gm7534 UTSW 4 134193099 missense probably benign 0.04
R5002:Gm7534 UTSW 4 134196920 missense probably benign 0.09
R5593:Gm7534 UTSW 4 134193039 missense probably damaging 0.99
R5606:Gm7534 UTSW 4 134200212 missense probably benign 0.13
R6553:Gm7534 UTSW 4 134202056 missense probably damaging 0.99
R6834:Gm7534 UTSW 4 134193165 missense possibly damaging 0.95
R6931:Gm7534 UTSW 4 134193153 missense probably benign 0.28
T0975:Gm7534 UTSW 4 134202629 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CATAGGCACGCCATACTGTATCCC -3'
(R):5'- TGCGTGAAGGTGTTTACCCCAG -3'

Sequencing Primer
(F):5'- TAGCAGTCTCCCTCTGGGTAAG -3'
(R):5'- TTACCCCAGGGACTTGTGG -3'
Posted On2014-03-14