Incidental Mutation 'R1458:Abce1'
ID161884
Institutional Source Beutler Lab
Gene Symbol Abce1
Ensembl Gene ENSMUSG00000058355
Gene NameATP-binding cassette, sub-family E (OABP), member 1
SynonymsOabp, Rnaseli, RNS4l (Eye)
MMRRC Submission 039513-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1458 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79683462-79711740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79707235 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 63 (K63R)
Ref Sequence ENSEMBL: ENSMUSP00000079379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048147] [ENSMUST00000080536] [ENSMUST00000210812]
Predicted Effect probably benign
Transcript: ENSMUST00000048147
SMART Domains Protein: ENSMUSP00000048244
Gene: ENSMUSG00000036977

DomainStartEndE-ValueType
APC10 22 184 7.76e-96 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080536
AA Change: K63R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079379
Gene: ENSMUSG00000058355
AA Change: K63R

DomainStartEndE-ValueType
Pfam:RLI 6 37 6.9e-18 PFAM
Pfam:Fer4 48 71 8e-10 PFAM
AAA 102 293 2.34e-8 SMART
low complexity region 343 358 N/A INTRINSIC
AAA 371 539 2.86e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182218
Predicted Effect probably benign
Transcript: ENSMUST00000210812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213842
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the OABP subfamily. Alternatively referred to as the RNase L inhibitor, this protein functions to block the activity of ribonuclease L. Activation of ribonuclease L leads to inhibition of protein synthesis in the 2-5A/RNase L system, the central pathway for viral interferon action. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Arhgef12 A G 9: 42,988,998 S860P probably damaging Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cic T C 7: 25,279,737 probably benign Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gm7534 T C 4: 134,196,833 D467G probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Mrpl21 A G 19: 3,284,808 Y50C possibly damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pde10a A T 17: 8,964,708 D832V probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Phf20l1 T A 15: 66,604,813 F253Y probably damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Abce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Abce1 APN 8 79693447 missense probably damaging 1.00
IGL01967:Abce1 APN 8 79685991 missense probably damaging 1.00
IGL02715:Abce1 APN 8 79690361 missense probably damaging 0.97
IGL02878:Abce1 APN 8 79703007 missense possibly damaging 0.94
IGL03080:Abce1 APN 8 79703001 splice site probably null
R0256:Abce1 UTSW 8 79685943 critical splice donor site probably null
R1871:Abce1 UTSW 8 79685268 nonsense probably null
R1872:Abce1 UTSW 8 79690251 missense possibly damaging 0.82
R1879:Abce1 UTSW 8 79687456 missense probably benign
R1957:Abce1 UTSW 8 79685949 missense probably benign 0.00
R4642:Abce1 UTSW 8 79689353 missense probably damaging 1.00
R4666:Abce1 UTSW 8 79687486 missense probably damaging 1.00
R5579:Abce1 UTSW 8 79700586 missense possibly damaging 0.94
R5583:Abce1 UTSW 8 79690293 missense probably benign
R5666:Abce1 UTSW 8 79690277 missense probably benign 0.01
R6484:Abce1 UTSW 8 79690323 missense probably damaging 0.98
R6671:Abce1 UTSW 8 79689177 missense probably benign 0.00
R7084:Abce1 UTSW 8 79699414 missense probably benign 0.13
R7098:Abce1 UTSW 8 79686049 missense probably benign
R7246:Abce1 UTSW 8 79703069 missense probably damaging 1.00
R7283:Abce1 UTSW 8 79685256 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCCTAACAAATGCCCAATACACTT -3'
(R):5'- CAAACTGAAGCCAGTCAGCTTACTCATA -3'

Sequencing Primer
(F):5'- ccccaaacaggaacacacac -3'
(R):5'- AGAATCTGTCCTACCAAACTCTG -3'
Posted On2014-03-14