Incidental Mutation 'R1458:Arhgef12'
ID161888
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 039513-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1458 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42988998 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 860 (S860P)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably damaging
Transcript: ENSMUST00000072767
AA Change: S859P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: S859P

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: S860P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: S860P

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Abce1 T C 8: 79,707,235 K63R possibly damaging Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cic T C 7: 25,279,737 probably benign Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gm7534 T C 4: 134,196,833 D467G probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Mrpl21 A G 19: 3,284,808 Y50C possibly damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pde10a A T 17: 8,964,708 D832V probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Phf20l1 T A 15: 66,604,813 F253Y probably damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGGAGCACTGAGTCTGATTGC -3'
(R):5'- GAGTCTTTCTGAGCTGGGCTACAC -3'

Sequencing Primer
(F):5'- CACTGAGTCTGATTGCATACTG -3'
(R):5'- CTGATTTGTACTACCAGTAGTTCGAT -3'
Posted On2014-03-14