Incidental Mutation 'R1458:Phf20l1'
ID161916
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene NamePHD finger protein 20-like 1
SynonymsCGI-72, E130113K22Rik
MMRRC Submission 039513-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R1458 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location66577560-66647976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66604813 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 253 (F253Y)
Ref Sequence ENSEMBL: ENSMUSP00000155538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]
Predicted Effect probably damaging
Transcript: ENSMUST00000048188
AA Change: F253Y

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: F253Y

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: F252Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229576
AA Change: F253Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230584
Predicted Effect probably damaging
Transcript: ENSMUST00000230882
AA Change: F252Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230915
Predicted Effect probably damaging
Transcript: ENSMUST00000230948
AA Change: F226Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik A G 9: 60,769,761 noncoding transcript Het
A430110L20Rik T A 1: 181,227,858 noncoding transcript Het
Abce1 T C 8: 79,707,235 K63R possibly damaging Het
Acp6 A G 3: 97,173,788 probably benign Het
Adamts13 T A 2: 26,988,354 L579Q probably damaging Het
Adamtsl3 T A 7: 82,523,320 M497K probably damaging Het
Adgrb2 T A 4: 130,014,591 M1042K possibly damaging Het
Akap12 A T 10: 4,353,693 S168C probably damaging Het
Akap3 A T 6: 126,865,554 M379L probably damaging Het
Aldh6a1 C T 12: 84,439,663 M135I probably null Het
Arhgef12 A G 9: 42,988,998 S860P probably damaging Het
Atp11b A C 3: 35,789,558 T185P probably damaging Het
Bcas1 T C 2: 170,387,951 D243G probably damaging Het
Cdhr2 T A 13: 54,717,872 S228T probably damaging Het
Cic T C 7: 25,279,737 probably benign Het
Cmya5 T A 13: 93,065,327 I3376L probably benign Het
Ctrc C A 4: 141,846,224 probably null Het
D230025D16Rik T C 8: 105,246,556 probably null Het
Dchs1 G T 7: 105,755,244 P2697Q probably damaging Het
Dmbt1 A G 7: 131,044,487 probably benign Het
Drd2 G A 9: 49,402,212 R227H probably damaging Het
Dscc1 C A 15: 55,086,764 C195F probably damaging Het
Dzip1 T A 14: 118,922,713 M28L probably benign Het
Edar A T 10: 58,607,366 S313T probably benign Het
Eef1e1 C A 13: 38,656,123 A69S probably damaging Het
Fbn1 A G 2: 125,301,929 V2760A probably benign Het
Fez1 GACAAACA GACA 9: 36,870,549 probably null Het
Fgl1 C G 8: 41,210,459 A11P possibly damaging Het
Fras1 T C 5: 96,600,733 V689A probably benign Het
Fry T A 5: 150,380,859 D571E probably damaging Het
Gm11232 T A 4: 71,757,213 R104* probably null Het
Gm1527 A G 3: 28,918,050 I439V possibly damaging Het
Gm4922 C A 10: 18,783,892 G361* probably null Het
Gm7052 T A 17: 22,040,466 probably benign Het
Gm7534 T C 4: 134,196,833 D467G probably benign Het
Gpatch8 A T 11: 102,481,229 S494R unknown Het
Gria2 A T 3: 80,732,045 V220E possibly damaging Het
Grik4 G A 9: 42,521,122 H860Y probably benign Het
Gtpbp1 A C 15: 79,707,729 S93R probably damaging Het
Gucy2g C A 19: 55,215,036 probably benign Het
Hist1h2ae C A 13: 23,571,047 probably benign Het
Hmcn1 G A 1: 150,609,700 R4384C probably damaging Het
Hspa12b G C 2: 131,145,192 A678P probably damaging Het
Igsf21 T A 4: 140,028,124 N407Y probably damaging Het
Insig2 A G 1: 121,307,156 Y174H probably benign Het
Itpr3 T A 17: 27,118,372 M2413K probably benign Het
Kalrn A T 16: 34,174,487 I1322N probably damaging Het
Klk1b24 T A 7: 44,191,466 M106K possibly damaging Het
Krt81 G T 15: 101,460,317 Q352K probably benign Het
Lca5l A T 16: 96,159,859 S468T possibly damaging Het
Lvrn T C 18: 46,882,385 probably benign Het
Mcpt1 T A 14: 56,019,164 probably benign Het
Med13l T C 5: 118,738,459 M900T probably benign Het
Med16 A G 10: 79,907,478 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mep1a T C 17: 43,491,672 H154R probably damaging Het
Mrc2 A T 11: 105,337,772 D659V probably benign Het
Mroh8 T A 2: 157,221,304 E799V probably damaging Het
Mrpl21 A G 19: 3,284,808 Y50C possibly damaging Het
Msl1 A G 11: 98,803,982 probably benign Het
Myo1a C A 10: 127,719,937 Q932K probably benign Het
Nav3 A C 10: 109,720,044 S1675R probably damaging Het
Neurl2 A G 2: 164,832,746 V232A possibly damaging Het
Nfatc1 T A 18: 80,665,267 probably benign Het
Odf3l2 A T 10: 79,645,558 probably benign Het
Olfr1362 C T 13: 21,611,822 C49Y probably benign Het
Olfr175-ps1 T A 16: 58,824,676 E11V probably null Het
P4hb A G 11: 120,562,555 probably benign Het
Papss1 T G 3: 131,605,854 I281S probably damaging Het
Pde10a A T 17: 8,964,708 D832V probably damaging Het
Pfkfb2 A T 1: 130,708,190 Y35N possibly damaging Het
Pkhd1l1 G A 15: 44,516,115 V1046I probably benign Het
Plin3 C T 17: 56,284,337 A148T probably benign Het
Ppp1r8 T C 4: 132,840,631 probably benign Het
Ppp2r3a A G 9: 101,211,312 L604P probably damaging Het
Prdm5 T C 6: 65,883,601 V239A probably damaging Het
Prickle1 A G 15: 93,500,638 S770P probably damaging Het
Prl2c5 T A 13: 13,190,725 I155N probably benign Het
Prom1 T C 5: 44,032,932 probably benign Het
Psg25 C T 7: 18,529,587 G104R probably damaging Het
Rbm19 T C 5: 120,144,029 V817A probably benign Het
Ryr2 T A 13: 11,727,022 Y2091F probably damaging Het
Slc16a4 A G 3: 107,300,932 T253A probably benign Het
Smg7 A T 1: 152,855,843 probably null Het
Spink5 C A 18: 44,007,719 H662N probably benign Het
Taf2 A T 15: 55,059,915 M322K probably damaging Het
Tmc2 T C 2: 130,248,762 F676S probably damaging Het
Tmem177 A G 1: 119,910,185 S255P possibly damaging Het
Trim46 A T 3: 89,235,068 probably null Het
Tubb1 T A 2: 174,450,803 probably null Het
Upf1 T C 8: 70,344,254 T110A probably benign Het
Vmn2r9 T A 5: 108,848,984 I140L probably benign Het
Zfp638 T A 6: 83,944,656 H588Q probably damaging Het
Zfp780b T A 7: 27,964,827 N101I probably damaging Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66629035 missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66615633 splice site probably benign
IGL00668:Phf20l1 APN 15 66632849 missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66636832 missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66641908 missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66613132 missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66597691 missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66628991 missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66640025 missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66615410 critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66641801 missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66615632 splice site probably benign
IGL02656:Phf20l1 APN 15 66629827 missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66604864 missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66594980 critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66595151 missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66594884 missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66641947 utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66597403 missense probably damaging 1.00
PIT4305001:Phf20l1 UTSW 15 66613052 missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66609604 missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66595122 missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66615630 splice site probably benign
R1619:Phf20l1 UTSW 15 66615259 missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66632825 missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66594920 missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66641816 missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66604837 missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66615222 missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66597367 missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66604855 missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66636913 missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66615785 missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66636820 missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66636824 missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66632903 critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66629824 missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66609547 missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66630913 missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66604840 missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66604789 missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66597750 missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66636884 missense probably damaging 1.00
X0065:Phf20l1 UTSW 15 66597678 missense probably damaging 0.99
X0065:Phf20l1 UTSW 15 66629806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCAACGTGCATAGTCACAGCAG -3'
(R):5'- CGCTAACATGAAGTCTCTAGCACCC -3'

Sequencing Primer
(F):5'- TGCTCCTAGCACAATAGGTG -3'
(R):5'- ATGAAGTCTCTAGCACCCCTACTC -3'
Posted On2014-03-14