Incidental Mutation 'R1459:Ano3'
ID161943
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
MMRRC Submission 039514-MU
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110880829 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 97 (A97S)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect probably benign
Transcript: ENSMUST00000099623
AA Change: A97S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: A97S

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Meta Mutation Damage Score 0.002 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 unclassified probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 intron probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTCATCATATCACTGTCGATGCAC -3'
(R):5'- GGTTGCCTATAGACTACCCCAGTTCA -3'

Sequencing Primer
(F):5'- ATATCACTGTCGATGCACTTACTTG -3'
(R):5'- CTTAAAGTGATGTGTGACAAAGTGG -3'
Posted On2014-03-14