Incidental Mutation 'R1459:Dvl1'
ID161954
Institutional Source Beutler Lab
Gene Symbol Dvl1
Ensembl Gene ENSMUSG00000029071
Gene Namedishevelled segment polarity protein 1
Synonyms
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155847402-155859303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155854019 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 133 (N133K)
Ref Sequence ENSEMBL: ENSMUSP00000133137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000168552]
Predicted Effect probably damaging
Transcript: ENSMUST00000030948
AA Change: N133K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071
AA Change: N133K

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably damaging
Transcript: ENSMUST00000168552
AA Change: N133K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071
AA Change: N133K

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Dishevelled family of proteins. These proteins have an N-terminal Dishevelled/Axin domain, a Dishevelled, EGL-10, Plextrin domain, a central PDZ domain, and a C-terminal domain of approximately 200 amino acids. They regulate both canonical and non-canonical Wnt signaling as well as planar cell polarity pathways. Mice deficient for this gene are viable and fertile but display reduced social interaction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are viable and fertile, but show a number of behavioral changes including deficient nest-building, less huddling contact during sleep, reduced subordinate responses, and other social interaction deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Dvl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Dvl1 APN 4 155853698 missense possibly damaging 0.85
IGL01930:Dvl1 APN 4 155856188 missense possibly damaging 0.72
IGL02499:Dvl1 APN 4 155854780 missense probably benign 0.10
IGL03075:Dvl1 APN 4 155854583 missense probably damaging 0.99
IGL03089:Dvl1 APN 4 155855152 missense probably damaging 1.00
R0525:Dvl1 UTSW 4 155855595 missense probably damaging 0.99
R0624:Dvl1 UTSW 4 155854775 missense probably damaging 1.00
R0633:Dvl1 UTSW 4 155858295 missense probably damaging 1.00
R1955:Dvl1 UTSW 4 155858029 missense possibly damaging 0.69
R1991:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2144:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2145:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2156:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2191:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2192:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2290:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2292:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2304:Dvl1 UTSW 4 155855584 missense probably damaging 0.98
R2519:Dvl1 UTSW 4 155855543 nonsense probably null
R3082:Dvl1 UTSW 4 155847859 missense possibly damaging 0.92
R3110:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R3112:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R4775:Dvl1 UTSW 4 155858127 missense probably benign
R5384:Dvl1 UTSW 4 155853686 missense probably damaging 0.99
R6148:Dvl1 UTSW 4 155854952 missense probably damaging 1.00
R6563:Dvl1 UTSW 4 155856253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAACATAGCAGGGGCCTACAG -3'
(R):5'- CTTCAGTCCTAACAGAATGCGGGTG -3'

Sequencing Primer
(F):5'- AGTTGTGTGGGAGGCACC -3'
(R):5'- TACCAGGCTGGGACCTCTAC -3'
Posted On2014-03-14