Incidental Mutation 'R1459:Nlrp10'
ID161968
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1459 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108924348 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 642 (M642L)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure
Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: M642L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: M642L

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1567:Nlrp10 UTSW 7 108927050 missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108924476 missense probably benign
R3616:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108924648 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGCTACTCAAAGTGACTTCACACC -3'
(R):5'- AGAATCGCTCCTTCGGTAAGGCAG -3'

Sequencing Primer
(F):5'- ATTGCACATGCTAAGACTCCTGG -3'
(R):5'- GAAGTCAGTTTCAGTGACAAGC -3'
Posted On2014-03-14