Incidental Mutation 'R1460:Nod2'
ID162068
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission 039515-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1460 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88663812 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 249 (E249G)
Ref Sequence ENSEMBL: ENSMUSP00000050538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect probably damaging
Transcript: ENSMUST00000054324
AA Change: E249G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: E249G

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109634
AA Change: E234G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: E234G

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118370
AA Change: E227G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: E227G

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124091
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.1%
Validation Efficiency 94% (93/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A T 4: 109,531,210 probably null Het
Abcb11 A G 2: 69,257,374 probably benign Het
Abi3bp T C 16: 56,562,417 V130A probably damaging Het
Adamts4 A G 1: 171,256,440 probably benign Het
Adgrd1 A G 5: 129,122,563 T155A possibly damaging Het
Ano3 A T 2: 110,682,758 S631T probably damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Atg7 G A 6: 114,703,364 A384T probably damaging Het
Atp6v0a1 T A 11: 101,033,998 I303N probably damaging Het
B3gntl1 T G 11: 121,639,798 Y149S probably damaging Het
Btnl2 A G 17: 34,366,450 D475G probably benign Het
Cdcp1 A T 9: 123,180,027 S529T possibly damaging Het
Cenpt A G 8: 105,848,888 L194P probably damaging Het
Chmp4b A G 2: 154,692,595 D177G possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cish G T 9: 107,300,397 E91* probably null Het
Col22a1 T C 15: 71,821,931 D740G unknown Het
Crocc G A 4: 141,029,240 Q1025* probably null Het
Ctrc C A 4: 141,838,809 probably benign Het
Cyb5r2 T A 7: 107,757,243 D7V probably benign Het
Dhx29 T C 13: 112,965,210 probably benign Het
Dhx9 A C 1: 153,465,680 D607E probably benign Het
Dirc2 T C 16: 35,719,366 T362A probably benign Het
Dnajb7 C T 15: 81,407,687 G150R probably benign Het
Dnase1l3 T A 14: 7,974,050 T214S probably benign Het
Dpm1 A T 2: 168,210,629 I229N probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Entpd1 T C 19: 40,726,188 V247A probably damaging Het
Ephb3 C A 16: 21,218,922 H277Q probably benign Het
Etl4 A T 2: 20,788,477 N671I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160a1 T C 3: 85,730,876 I39V probably damaging Het
Fancd2os G A 6: 113,598,012 T11I probably damaging Het
Fcrlb G T 1: 170,912,284 probably benign Het
Gm4788 T A 1: 139,698,196 I788F probably damaging Het
Gm9268 A T 7: 43,023,215 R91S probably benign Het
Gm9991 T C 1: 90,679,058 noncoding transcript Het
Gstk1 C T 6: 42,246,595 R40W probably damaging Het
Gstt1 C T 10: 75,784,170 V190M probably damaging Het
Hectd2 G A 19: 36,615,508 W691* probably null Het
Hecw2 T C 1: 53,813,245 T1572A probably damaging Het
Hoxa5 T C 6: 52,203,948 T135A probably benign Het
Igfl3 T A 7: 18,179,955 C77S possibly damaging Het
Itgb4 A G 11: 115,984,164 D449G probably damaging Het
Larp1b T C 3: 40,962,218 V11A probably benign Het
Lhx9 A G 1: 138,838,709 probably benign Het
Lig3 G T 11: 82,795,798 probably benign Het
Lipo4 A C 19: 33,499,318 F343L probably benign Het
Lyn T A 4: 3,789,908 Y480* probably null Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mill1 C A 7: 18,262,670 A137D probably damaging Het
Morc2a A T 11: 3,683,794 R635S probably benign Het
Mpped2 A G 2: 106,744,892 probably benign Het
Mug2 T C 6: 122,040,533 probably benign Het
Mut T C 17: 40,937,375 Y98H probably damaging Het
Mynn C A 3: 30,603,704 S57Y probably damaging Het
Myo3b G A 2: 70,232,454 E333K probably benign Het
Myt1 A T 2: 181,802,932 I514F probably damaging Het
Nlrp4f A G 13: 65,190,268 C708R probably benign Het
Npy2r T C 3: 82,540,944 I175V probably benign Het
Obscn A T 11: 59,055,966 V4114D probably damaging Het
Olfr1249 A G 2: 89,629,938 probably null Het
Olfr1382 T A 11: 49,535,677 M164K possibly damaging Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr676 T A 7: 105,035,708 I170N possibly damaging Het
Olfr952 A G 9: 39,426,207 M288T probably benign Het
Pbxip1 T A 3: 89,445,614 I196N probably damaging Het
Piezo1 G A 8: 122,502,151 T209M possibly damaging Het
Polr1a T C 6: 71,941,384 M642T probably damaging Het
Prdm4 T C 10: 85,907,822 M190V probably benign Het
Psmd7 G A 8: 107,581,059 S264L possibly damaging Het
Qrich1 T G 9: 108,533,647 probably benign Het
Rapgef4 G T 2: 72,031,176 probably null Het
Rfx5 T C 3: 94,956,325 I95T probably damaging Het
Rgr G A 14: 37,045,726 R113C probably damaging Het
Rnf20 T C 4: 49,645,873 probably benign Het
Rps3a1 G A 3: 86,138,062 A241V probably benign Het
Rsg1 T C 4: 141,218,212 F125L probably damaging Het
Rttn A T 18: 89,109,357 probably benign Het
Scn2a A G 2: 65,701,843 T600A probably damaging Het
Scyl2 T C 10: 89,657,889 D339G possibly damaging Het
Sipa1 T A 19: 5,651,447 H1029L probably benign Het
Snrnp48 A G 13: 38,211,105 T124A probably benign Het
Sptbn1 A T 11: 30,138,637 M875K possibly damaging Het
Supt6 A G 11: 78,222,198 V973A possibly damaging Het
Supv3l1 T C 10: 62,443,383 probably benign Het
Svep1 G T 4: 58,068,740 N3015K possibly damaging Het
Tgfb3 A G 12: 86,059,067 probably benign Het
Trerf1 A G 17: 47,317,845 noncoding transcript Het
Trim24 T A 6: 37,964,826 F904I probably damaging Het
Trim30d T A 7: 104,472,104 Y328F probably benign Het
Ttn T C 2: 76,868,373 E6G probably damaging Het
Ube2m T C 7: 13,035,835 probably benign Het
Wdr90 A T 17: 25,860,448 S237R possibly damaging Het
Zfp735 A T 11: 73,712,333 H701L possibly damaging Het
Zp1 T C 19: 10,918,878 D161G probably benign Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
PIT4687001:Nod2 UTSW 8 88681646 missense probably damaging 1.00
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0391:Nod2 UTSW 8 88663778 missense probably benign 0.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R0815:Nod2 UTSW 8 88672662 splice site probably benign
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1934:Nod2 UTSW 8 88663719 missense probably benign
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R4756:Nod2 UTSW 8 88664274 missense possibly damaging 0.59
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 intron probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6282:Nod2 UTSW 8 88670460 missense probably benign 0.02
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
R7008:Nod2 UTSW 8 88663657 nonsense probably null
R7182:Nod2 UTSW 8 88663832 missense probably benign 0.01
R7324:Nod2 UTSW 8 88653066 missense probably damaging 1.00
R7344:Nod2 UTSW 8 88660582 missense probably damaging 1.00
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCATTCCCCATGCAGGCTAC -3'
(R):5'- GAAGACATCGTCCTGAGCGACATC -3'

Sequencing Primer
(F):5'- AGCTGCTGAGTGTCAGAAGT -3'
(R):5'- TGCTCAAAGAGCAGCGTC -3'
Posted On2014-03-14