Incidental Mutation 'R1460:Dhx29'
ID162093
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 039515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1460 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 112965210 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably benign
Transcript: ENSMUST00000038574
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.1%
Validation Efficiency 94% (93/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A T 4: 109,531,210 probably null Het
Abcb11 A G 2: 69,257,374 probably benign Het
Abi3bp T C 16: 56,562,417 V130A probably damaging Het
Adamts4 A G 1: 171,256,440 probably benign Het
Adgrd1 A G 5: 129,122,563 T155A possibly damaging Het
Ano3 A T 2: 110,682,758 S631T probably damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Atg7 G A 6: 114,703,364 A384T probably damaging Het
Atp6v0a1 T A 11: 101,033,998 I303N probably damaging Het
B3gntl1 T G 11: 121,639,798 Y149S probably damaging Het
Btnl2 A G 17: 34,366,450 D475G probably benign Het
Cdcp1 A T 9: 123,180,027 S529T possibly damaging Het
Cenpt A G 8: 105,848,888 L194P probably damaging Het
Chmp4b A G 2: 154,692,595 D177G possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cish G T 9: 107,300,397 E91* probably null Het
Col22a1 T C 15: 71,821,931 D740G unknown Het
Crocc G A 4: 141,029,240 Q1025* probably null Het
Ctrc C A 4: 141,838,809 probably benign Het
Cyb5r2 T A 7: 107,757,243 D7V probably benign Het
Dhx9 A C 1: 153,465,680 D607E probably benign Het
Dirc2 T C 16: 35,719,366 T362A probably benign Het
Dnajb7 C T 15: 81,407,687 G150R probably benign Het
Dnase1l3 T A 14: 7,974,050 T214S probably benign Het
Dpm1 A T 2: 168,210,629 I229N probably damaging Het
Dstn T C 2: 143,938,488 V36A possibly damaging Het
Entpd1 T C 19: 40,726,188 V247A probably damaging Het
Ephb3 C A 16: 21,218,922 H277Q probably benign Het
Etl4 A T 2: 20,788,477 N671I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160a1 T C 3: 85,730,876 I39V probably damaging Het
Fancd2os G A 6: 113,598,012 T11I probably damaging Het
Fcrlb G T 1: 170,912,284 probably benign Het
Gm4788 T A 1: 139,698,196 I788F probably damaging Het
Gm9268 A T 7: 43,023,215 R91S probably benign Het
Gm9991 T C 1: 90,679,058 noncoding transcript Het
Gstk1 C T 6: 42,246,595 R40W probably damaging Het
Gstt1 C T 10: 75,784,170 V190M probably damaging Het
Hectd2 G A 19: 36,615,508 W691* probably null Het
Hecw2 T C 1: 53,813,245 T1572A probably damaging Het
Hoxa5 T C 6: 52,203,948 T135A probably benign Het
Igfl3 T A 7: 18,179,955 C77S possibly damaging Het
Itgb4 A G 11: 115,984,164 D449G probably damaging Het
Larp1b T C 3: 40,962,218 V11A probably benign Het
Lhx9 A G 1: 138,838,709 probably benign Het
Lig3 G T 11: 82,795,798 probably benign Het
Lipo4 A C 19: 33,499,318 F343L probably benign Het
Lyn T A 4: 3,789,908 Y480* probably null Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mill1 C A 7: 18,262,670 A137D probably damaging Het
Morc2a A T 11: 3,683,794 R635S probably benign Het
Mpped2 A G 2: 106,744,892 probably benign Het
Mug2 T C 6: 122,040,533 probably benign Het
Mut T C 17: 40,937,375 Y98H probably damaging Het
Mynn C A 3: 30,603,704 S57Y probably damaging Het
Myo3b G A 2: 70,232,454 E333K probably benign Het
Myt1 A T 2: 181,802,932 I514F probably damaging Het
Nlrp4f A G 13: 65,190,268 C708R probably benign Het
Nod2 A G 8: 88,663,812 E249G probably damaging Het
Npy2r T C 3: 82,540,944 I175V probably benign Het
Obscn A T 11: 59,055,966 V4114D probably damaging Het
Olfr1249 A G 2: 89,629,938 probably null Het
Olfr1382 T A 11: 49,535,677 M164K possibly damaging Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr676 T A 7: 105,035,708 I170N possibly damaging Het
Olfr952 A G 9: 39,426,207 M288T probably benign Het
Pbxip1 T A 3: 89,445,614 I196N probably damaging Het
Piezo1 G A 8: 122,502,151 T209M possibly damaging Het
Polr1a T C 6: 71,941,384 M642T probably damaging Het
Prdm4 T C 10: 85,907,822 M190V probably benign Het
Psmd7 G A 8: 107,581,059 S264L possibly damaging Het
Qrich1 T G 9: 108,533,647 probably benign Het
Rapgef4 G T 2: 72,031,176 probably null Het
Rfx5 T C 3: 94,956,325 I95T probably damaging Het
Rgr G A 14: 37,045,726 R113C probably damaging Het
Rnf20 T C 4: 49,645,873 probably benign Het
Rps3a1 G A 3: 86,138,062 A241V probably benign Het
Rsg1 T C 4: 141,218,212 F125L probably damaging Het
Rttn A T 18: 89,109,357 probably benign Het
Scn2a A G 2: 65,701,843 T600A probably damaging Het
Scyl2 T C 10: 89,657,889 D339G possibly damaging Het
Sipa1 T A 19: 5,651,447 H1029L probably benign Het
Snrnp48 A G 13: 38,211,105 T124A probably benign Het
Sptbn1 A T 11: 30,138,637 M875K possibly damaging Het
Supt6 A G 11: 78,222,198 V973A possibly damaging Het
Supv3l1 T C 10: 62,443,383 probably benign Het
Svep1 G T 4: 58,068,740 N3015K possibly damaging Het
Tgfb3 A G 12: 86,059,067 probably benign Het
Trerf1 A G 17: 47,317,845 noncoding transcript Het
Trim24 T A 6: 37,964,826 F904I probably damaging Het
Trim30d T A 7: 104,472,104 Y328F probably benign Het
Ttn T C 2: 76,868,373 E6G probably damaging Het
Ube2m T C 7: 13,035,835 probably benign Het
Wdr90 A T 17: 25,860,448 S237R possibly damaging Het
Zfp735 A T 11: 73,712,333 H701L possibly damaging Het
Zp1 T C 19: 10,918,878 D161G probably benign Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCGCGTTGGAAATCCGACACAC -3'
(R):5'- TGCTCTCATCAGGTCATCTGGACTG -3'

Sequencing Primer
(F):5'- AAGATAGCAAGGCTTCTCTCTGG -3'
(R):5'- CATCAGGTCATCTGGACTGGATAC -3'
Posted On2014-03-14