Incidental Mutation 'R1450:Hs2st1'
ID162129
Institutional Source Beutler Lab
Gene Symbol Hs2st1
Ensembl Gene ENSMUSG00000040151
Gene Nameheparan sulfate 2-O-sulfotransferase 1
SynonymsHs2st
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R1450 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144429706-144570181 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 144434718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043325]
Predicted Effect probably benign
Transcript: ENSMUST00000043325
SMART Domains Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
Pfam:Sulfotransfer_2 66 327 9.1e-44 PFAM
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Hs2st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0037:Hs2st1 UTSW 3 144437644 nonsense probably null
R1215:Hs2st1 UTSW 3 144465141 missense possibly damaging 0.75
R1474:Hs2st1 UTSW 3 144435495 missense possibly damaging 0.94
R1505:Hs2st1 UTSW 3 144434561 missense probably benign 0.19
R1695:Hs2st1 UTSW 3 144434654 missense probably benign 0.00
R2511:Hs2st1 UTSW 3 144569930 unclassified probably benign
R2967:Hs2st1 UTSW 3 144465138 missense probably damaging 1.00
R3928:Hs2st1 UTSW 3 144434628 missense possibly damaging 0.55
R4895:Hs2st1 UTSW 3 144465253 missense probably benign
R4911:Hs2st1 UTSW 3 144465082 missense probably benign 0.23
R5477:Hs2st1 UTSW 3 144556948 critical splice donor site probably benign
R5666:Hs2st1 UTSW 3 144569793 missense probably damaging 0.97
R6262:Hs2st1 UTSW 3 144434613 missense probably damaging 0.96
X0019:Hs2st1 UTSW 3 144454012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACCTGCGCTCAGTTCGACTTAG -3'
(R):5'- TGGCAGGAGCCCAGATATGTGATAG -3'

Sequencing Primer
(F):5'- GCTCAGTTCGACTTAGGGTAAATC -3'
(R):5'- GGTGAGAGACTCCACTTACTG -3'
Posted On2014-03-14