Incidental Mutation 'R1450:Herc3'
ID162142
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1450 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58876515 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 554 (K554*)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401]
Predicted Effect probably null
Transcript: ENSMUST00000031823
AA Change: K554*
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: K554*

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041401
AA Change: K554*
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: K554*

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204196
Meta Mutation Damage Score 0.66 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Bag6 T A 17: 35,141,958 D422E probably benign Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 unclassified probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGTAGGTGCATTCTGCATCC -3'
(R):5'- TTGGAAAATCTCCGAGAGAAAGCCC -3'

Sequencing Primer
(F):5'- aggggagagagagggagag -3'
(R):5'- GGCAGAATCCTGCATCCCTC -3'
Posted On2014-03-14